Incidental Mutation 'R0992:Uchl3'
ID97803
Institutional Source Beutler Lab
Gene Symbol Uchl3
Ensembl Gene ENSMUSG00000022111
Gene Nameubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
Synonyms
MMRRC Submission 039112-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R0992 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location101653967-101696125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101668533 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 144 (I144T)
Ref Sequence ENSEMBL: ENSMUSP00000002289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002289]
Predicted Effect probably benign
Transcript: ENSMUST00000002289
AA Change: I144T

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000002289
Gene: ENSMUSG00000022111
AA Change: I144T

DomainStartEndE-ValueType
Pfam:Peptidase_C12 6 214 1.2e-68 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000226340
AA Change: I114T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228773
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the deubiquitinating enzyme family. Members of this family are proteases that catalyze the removal of ubiquitin from polypeptides and are divided into five classes, depending on the mechanism of catalysis. This protein may hydrolyze the ubiquitinyl-N-epsilon amide bond of ubiquitinated proteins to regenerate ubiquitin for another catalytic cycle. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null animals show degeneration in dorsal root ganglia. Mice display postnatal progressive retinal degeneration and muscular degeneration. In combination with a knockout of ubiquitin C-terminal hydrolase L1, neurological effects of each are accelerated, mice are dysphagic and die younger. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,211,684 T905A probably damaging Het
Arhgap20 A G 9: 51,816,786 R100G probably damaging Het
Bsn G A 9: 108,114,354 R1400* probably null Het
Clstn2 A G 9: 97,445,712 S948P probably benign Het
Col15a1 G A 4: 47,300,491 V1029M probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Disc1 T C 8: 125,088,042 I215T probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dst A G 1: 34,199,536 N3773S probably damaging Het
Gdap1 A G 1: 17,147,105 Y96C probably damaging Het
Glipr1l1 A G 10: 112,062,325 R112G probably benign Het
Gria4 A G 9: 4,795,238 S13P probably benign Het
Noxred1 T C 12: 87,224,226 N207S probably benign Het
Pom121l2 A T 13: 21,982,759 Q400L probably benign Het
Sla2 T C 2: 156,874,472 E243G probably damaging Het
Srpk2 A G 5: 23,545,543 I54T probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Trim15 C T 17: 36,865,011 V215M probably damaging Het
Other mutations in Uchl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0507:Uchl3 UTSW 14 101667007 nonsense probably null
R1365:Uchl3 UTSW 14 101654092 missense probably damaging 1.00
R2213:Uchl3 UTSW 14 101666670 critical splice donor site probably null
R2875:Uchl3 UTSW 14 101668560 missense probably benign 0.02
R5027:Uchl3 UTSW 14 101666546 missense possibly damaging 0.93
R5186:Uchl3 UTSW 14 101695917 missense probably damaging 1.00
R6737:Uchl3 UTSW 14 101690597 missense probably damaging 0.99
R7039:Uchl3 UTSW 14 101685692 intron probably benign
R8308:Uchl3 UTSW 14 101695219 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGGGTAGAAAGGACAGCACCTC -3'
(R):5'- TAATGTAGCACGGTAGCAGCCTGG -3'

Sequencing Primer
(F):5'- TAGAAAGGACAGCACCTCATTTG -3'
(R):5'- TAGCAGCCTGGCAAAACATTTC -3'
Posted On2014-01-05