Incidental Mutation 'R1119:Cul2'
ID 97804
Institutional Source Beutler Lab
Gene Symbol Cul2
Ensembl Gene ENSMUSG00000024231
Gene Name cullin 2
Synonyms 4932411N15Rik, 1300003D18Rik
MMRRC Submission 039192-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R1119 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 3382988-3436377 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 3419335 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025073] [ENSMUST00000080089] [ENSMUST00000161317] [ENSMUST00000162301]
AlphaFold Q9D4H8
Predicted Effect probably benign
Transcript: ENSMUST00000025073
SMART Domains Protein: ENSMUSP00000025073
Gene: ENSMUSG00000024231

SCOP:d1ldja2 11 386 1e-109 SMART
CULLIN 416 568 1.19e-84 SMART
low complexity region 636 646 N/A INTRINSIC
Pfam:Cullin_Nedd8 651 700 9.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080089
SMART Domains Protein: ENSMUSP00000078988
Gene: ENSMUSG00000024231

Pfam:Cullin 14 88 2.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161317
SMART Domains Protein: ENSMUSP00000123903
Gene: ENSMUSG00000024231

CULLIN 353 505 1.19e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162301
SMART Domains Protein: ENSMUSP00000125403
Gene: ENSMUSG00000024231

SCOP:d1ldja2 11 386 1e-108 SMART
CULLIN 416 568 1.19e-84 SMART
low complexity region 636 646 N/A INTRINSIC
Cullin_Nedd8 672 739 1.01e-33 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,987,045 V2524G probably damaging Het
Adamtsl3 A C 7: 82,540,317 E583A probably damaging Het
Aoah T A 13: 20,914,938 probably benign Het
Atf7ip2 A G 16: 10,240,612 K305R possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Cfap57 G A 4: 118,606,676 Q327* probably null Het
Ckap2l A T 2: 129,272,572 probably benign Het
Ddx60 G A 8: 61,942,544 V172M probably damaging Het
Drp2 T C X: 134,441,322 L545P probably damaging Het
Ezh1 A G 11: 101,210,535 probably benign Het
Gipc2 A G 3: 152,094,196 F299S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hikeshi A G 7: 89,935,730 S89P probably benign Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Larp1b C A 3: 41,033,528 R62S possibly damaging Het
Lgr5 A T 10: 115,460,811 probably null Het
Lpin1 C A 12: 16,563,721 D449Y probably damaging Het
Macrod2 A T 2: 140,400,906 I31L probably benign Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nxpe5 G A 5: 138,239,396 D61N probably benign Het
Ogdh T A 11: 6,340,544 H376Q probably damaging Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb14 G A 18: 37,448,587 V249M probably damaging Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pik3r6 C T 11: 68,545,872 T654I probably benign Het
Rptn A G 3: 93,396,245 Y295C possibly damaging Het
Sec16b A G 1: 157,564,834 D924G possibly damaging Het
Setd1b C A 5: 123,147,716 T275K unknown Het
Sgcb T A 5: 73,644,414 K36I probably damaging Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stab2 T C 10: 86,859,755 D599G possibly damaging Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tax1bp1 C A 6: 52,741,948 probably benign Het
Thnsl1 A G 2: 21,213,046 N16S probably damaging Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r60 A T 7: 42,194,941 Q576L possibly damaging Het
Zfp62 G T 11: 49,216,690 R536L probably damaging Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Cul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Cul2 APN 18 3423487 missense probably benign
IGL01293:Cul2 APN 18 3419426 missense probably damaging 0.99
IGL02719:Cul2 APN 18 3434052 missense probably damaging 1.00
IGL02886:Cul2 APN 18 3426920 splice site probably benign
IGL03190:Cul2 APN 18 3429634 missense possibly damaging 0.95
IGL03389:Cul2 APN 18 3431029 missense probably benign 0.00
IGL03409:Cul2 APN 18 3429593 missense probably damaging 1.00
R0238:Cul2 UTSW 18 3414115 splice site probably benign
R1013:Cul2 UTSW 18 3425535 nonsense probably null
R1743:Cul2 UTSW 18 3426851 missense probably damaging 1.00
R1897:Cul2 UTSW 18 3414164 missense probably benign
R2252:Cul2 UTSW 18 3399876 missense probably damaging 1.00
R2253:Cul2 UTSW 18 3399876 missense probably damaging 1.00
R3898:Cul2 UTSW 18 3434033 missense probably benign 0.07
R4386:Cul2 UTSW 18 3434856 missense probably damaging 1.00
R4579:Cul2 UTSW 18 3430957 missense probably benign 0.00
R4828:Cul2 UTSW 18 3431013 missense probably damaging 1.00
R6085:Cul2 UTSW 18 3431508 missense probably benign 0.01
R6429:Cul2 UTSW 18 3421345 missense probably damaging 1.00
R6480:Cul2 UTSW 18 3417561 missense possibly damaging 0.89
R6805:Cul2 UTSW 18 3421263 missense probably damaging 1.00
R6825:Cul2 UTSW 18 3434946 missense probably damaging 0.99
R7343:Cul2 UTSW 18 3426873 missense probably benign 0.08
R7690:Cul2 UTSW 18 3419420 missense probably benign 0.09
R8114:Cul2 UTSW 18 3426164 nonsense probably null
R8414:Cul2 UTSW 18 3399912 missense probably benign 0.08
R8736:Cul2 UTSW 18 3434019 missense probably damaging 0.99
R8849:Cul2 UTSW 18 3423551 missense probably benign 0.00
R9199:Cul2 UTSW 18 3423577 missense probably benign 0.00
R9443:Cul2 UTSW 18 3434041 nonsense probably null
X0067:Cul2 UTSW 18 3419435 missense possibly damaging 0.62
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aaaccaatacttttacttttttcccc -3'
Posted On 2014-01-05