Incidental Mutation 'R1119:Drp2'
ID97808
Institutional Source Beutler Lab
Gene Symbol Drp2
Ensembl Gene ENSMUSG00000000223
Gene Namedystrophin related protein 2
Synonyms
MMRRC Submission 039192-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1119 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location134404551-134456573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134441322 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 545 (L545P)
Ref Sequence ENSEMBL: ENSMUSP00000115246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113224] [ENSMUST00000113226] [ENSMUST00000113228] [ENSMUST00000153424]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000000228
Predicted Effect probably damaging
Transcript: ENSMUST00000113224
AA Change: L569P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108850
Gene: ENSMUSG00000000223
AA Change: L569P

DomainStartEndE-ValueType
SPEC 129 251 5e-7 SMART
SPEC 258 360 6.4e-7 SMART
WW 377 409 4.6e-10 SMART
Pfam:EF-hand_2 410 528 9.5e-36 PFAM
Pfam:EF-hand_3 532 623 9.1e-35 PFAM
ZnF_ZZ 628 673 1e-17 SMART
coiled coil region 800 900 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113226
AA Change: L545P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108852
Gene: ENSMUSG00000000223
AA Change: L545P

DomainStartEndE-ValueType
SPEC 105 227 7.58e-5 SMART
SPEC 234 336 1e-4 SMART
WW 353 385 8.03e-8 SMART
Pfam:EF-hand_3 508 599 2e-35 PFAM
ZnF_ZZ 604 649 2.03e-15 SMART
coiled coil region 776 876 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113228
AA Change: L545P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108854
Gene: ENSMUSG00000000223
AA Change: L545P

DomainStartEndE-ValueType
SPEC 105 227 7.58e-5 SMART
SPEC 234 336 1e-4 SMART
WW 353 385 8.03e-8 SMART
Pfam:EF-hand_3 508 599 2e-35 PFAM
ZnF_ZZ 604 649 2.03e-15 SMART
coiled coil region 776 876 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153424
AA Change: L545P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115246
Gene: ENSMUSG00000000223
AA Change: L545P

DomainStartEndE-ValueType
SPEC 105 227 7.58e-5 SMART
SPEC 234 336 1e-4 SMART
WW 353 385 8.03e-8 SMART
Pfam:EF-hand_3 508 599 2e-35 PFAM
ZnF_ZZ 604 649 2.03e-15 SMART
coiled coil region 776 876 N/A INTRINSIC
Meta Mutation Damage Score 0.8767 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the dystrophin family of proteins perform a critical role in the maintenance of membrane-associated complexes at points of intercellular contact in vertebrate cells. The protein encoded by this gene is predicted to resemble certain short C-terminal isoforms of dystrophin and dystrophin-related protein 1 (DRP1 or utrophin). DRP2 is expressed principally in the brain and spinal cord. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a conditional allele activated in peripheral nerves exhibit abnormal Scwann cell morphology, supernumerary Schwann cell, abnormal myelin sheath morphology and hypermyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,987,045 V2524G probably damaging Het
Adamtsl3 A C 7: 82,540,317 E583A probably damaging Het
Aoah T A 13: 20,914,938 probably benign Het
Atf7ip2 A G 16: 10,240,612 K305R possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Cfap57 G A 4: 118,606,676 Q327* probably null Het
Ckap2l A T 2: 129,272,572 probably benign Het
Cul2 A G 18: 3,419,335 probably benign Het
Ddx60 G A 8: 61,942,544 V172M probably damaging Het
Ezh1 A G 11: 101,210,535 probably benign Het
Gipc2 A G 3: 152,094,196 F299S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hikeshi A G 7: 89,935,730 S89P probably benign Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Larp1b C A 3: 41,033,528 R62S possibly damaging Het
Lgr5 A T 10: 115,460,811 probably null Het
Lpin1 C A 12: 16,563,721 D449Y probably damaging Het
Macrod2 A T 2: 140,400,906 I31L probably benign Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nxpe5 G A 5: 138,239,396 D61N probably benign Het
Ogdh T A 11: 6,340,544 H376Q probably damaging Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb14 G A 18: 37,448,587 V249M probably damaging Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pik3r6 C T 11: 68,545,872 T654I probably benign Het
Rptn A G 3: 93,396,245 Y295C possibly damaging Het
Sec16b A G 1: 157,564,834 D924G possibly damaging Het
Setd1b C A 5: 123,147,716 T275K unknown Het
Sgcb T A 5: 73,644,414 K36I probably damaging Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stab2 T C 10: 86,859,755 D599G possibly damaging Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tax1bp1 C A 6: 52,741,948 probably benign Het
Thnsl1 A G 2: 21,213,046 N16S probably damaging Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r60 A T 7: 42,194,941 Q576L possibly damaging Het
Zfp62 G T 11: 49,216,690 R536L probably damaging Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Drp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1864:Drp2 UTSW X 134427115 missense probably benign 0.03
R3618:Drp2 UTSW X 134439968 missense probably benign 0.13
R4367:Drp2 UTSW X 134435135 intron probably benign
R4371:Drp2 UTSW X 134435135 intron probably benign
R4993:Drp2 UTSW X 134441316 missense probably damaging 0.99
R4994:Drp2 UTSW X 134441316 missense probably damaging 0.99
R4996:Drp2 UTSW X 134441316 missense probably damaging 0.99
Z1177:Drp2 UTSW X 134437042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGCATCCACATCTGGCACTACC -3'
(R):5'- AGTACATTGCACCCAAAGCTGAGAG -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctc -3'
(R):5'- CCCAAAGCTGAGAGGCTGG -3'
Posted On2014-01-05