Incidental Mutation 'R0992:Trim15'
ID97809
Institutional Source Beutler Lab
Gene Symbol Trim15
Ensembl Gene ENSMUSG00000050747
Gene Nametripartite motif-containing 15
Synonyms1810012B10Rik
MMRRC Submission 039112-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R0992 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location36860691-36867210 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36865011 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 215 (V215M)
Ref Sequence ENSEMBL: ENSMUSP00000133953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025329] [ENSMUST00000060524] [ENSMUST00000174195]
Predicted Effect probably damaging
Transcript: ENSMUST00000025329
AA Change: V215M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025329
Gene: ENSMUSG00000050747
AA Change: V215M

DomainStartEndE-ValueType
RING 15 53 2e-4 SMART
BBOX 73 114 2.41e-12 SMART
coiled coil region 145 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060524
SMART Domains Protein: ENSMUSP00000057928
Gene: ENSMUSG00000073400

DomainStartEndE-ValueType
RING 16 60 1.2e-7 SMART
BBOX 94 135 5.38e-10 SMART
coiled coil region 152 175 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
PRY 309 361 1.04e-25 SMART
SPRY 362 485 1.51e-23 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173639
AA Change: V96M
SMART Domains Protein: ENSMUSP00000133638
Gene: ENSMUSG00000050747
AA Change: V96M

DomainStartEndE-ValueType
SCOP:d1dkza_ 15 105 1e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174195
AA Change: V215M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133953
Gene: ENSMUSG00000050747
AA Change: V215M

DomainStartEndE-ValueType
RING 15 53 2e-4 SMART
BBOX 73 114 2.41e-12 SMART
coiled coil region 145 229 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,211,684 T905A probably damaging Het
Arhgap20 A G 9: 51,816,786 R100G probably damaging Het
Bsn G A 9: 108,114,354 R1400* probably null Het
Clstn2 A G 9: 97,445,712 S948P probably benign Het
Col15a1 G A 4: 47,300,491 V1029M probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Disc1 T C 8: 125,088,042 I215T probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dst A G 1: 34,199,536 N3773S probably damaging Het
Gdap1 A G 1: 17,147,105 Y96C probably damaging Het
Glipr1l1 A G 10: 112,062,325 R112G probably benign Het
Gria4 A G 9: 4,795,238 S13P probably benign Het
Noxred1 T C 12: 87,224,226 N207S probably benign Het
Pom121l2 A T 13: 21,982,759 Q400L probably benign Het
Sla2 T C 2: 156,874,472 E243G probably damaging Het
Srpk2 A G 5: 23,545,543 I54T probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Uchl3 T C 14: 101,668,533 I144T probably benign Het
Other mutations in Trim15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Trim15 APN 17 36865083 missense probably damaging 0.97
IGL02135:Trim15 APN 17 36867064 missense probably benign 0.00
IGL03024:Trim15 APN 17 36866893 missense probably damaging 1.00
R0310:Trim15 UTSW 17 36866986 missense probably damaging 1.00
R0490:Trim15 UTSW 17 36866355 missense probably benign
R1775:Trim15 UTSW 17 36865169 missense probably benign 0.15
R1957:Trim15 UTSW 17 36862323 unclassified probably benign
R3625:Trim15 UTSW 17 36866876 missense possibly damaging 0.74
R4520:Trim15 UTSW 17 36866350 missense probably benign 0.01
R4845:Trim15 UTSW 17 36866983 missense probably benign 0.00
R5644:Trim15 UTSW 17 36866821 missense probably damaging 0.99
R5838:Trim15 UTSW 17 36862840 missense probably damaging 1.00
R5930:Trim15 UTSW 17 36862360 critical splice acceptor site probably null
R6758:Trim15 UTSW 17 36862341 missense probably benign 0.16
R7094:Trim15 UTSW 17 36862896 missense probably benign
R7849:Trim15 UTSW 17 36866872 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCAGCACCACACATGGGTTATTCC -3'
(R):5'- TCCTCACAGATGCAGGTTGAAAGC -3'

Sequencing Primer
(F):5'- CCAAACTCAAGATGGTCTGATG -3'
(R):5'- CAGGTTGAAAGCAAAAAGCATC -3'
Posted On2014-01-05