Incidental Mutation 'R1099:Cd160'
ID97847
Institutional Source Beutler Lab
Gene Symbol Cd160
Ensembl Gene ENSMUSG00000038304
Gene NameCD160 antigen
SynonymsBy55
MMRRC Submission 039173-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1099 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96798763-96829351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96805840 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 36 (A36V)
Ref Sequence ENSEMBL: ENSMUSP00000102689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047702] [ENSMUST00000107074] [ENSMUST00000165991]
Predicted Effect probably damaging
Transcript: ENSMUST00000047702
AA Change: A36V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037466
Gene: ENSMUSG00000038304
AA Change: A36V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IG 32 136 3.85e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107074
AA Change: A36V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102689
Gene: ENSMUSG00000038304
AA Change: A36V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IG 32 136 3.85e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165991
AA Change: A36V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132363
Gene: ENSMUSG00000038304
AA Change: A36V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 32 136 1.5e-7 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD160 is an 27 kDa glycoprotein which was initially identified with the monoclonal antibody BY55. Its expression is tightly associated with peripheral blood NK cells and CD8 T lymphocytes with cytolytic effector activity. The cDNA sequence of CD160 predicts a cysteine-rich, glycosylphosphatidylinositol-anchored protein of 181 amino acids with a single Ig-like domain weakly homologous to KIR2DL4 molecule. CD160 is expressed at the cell surface as a tightly disulfide-linked multimer. RNA blot analysis revealed CD160 mRNAs of 1.5 and 1.6 kb whose expression was highly restricted to circulating NK and T cells, spleen and small intestine. Within NK cells CD160 is expressed by CD56dimCD16+ cells whereas among circulating T cells its expression is mainly restricted to TCRgd bearing cells and to TCRab+CD8brightCD95+CD56+CD28-CD27-cells. In tissues, CD160 is expressed on all intestinal intraepithelial lymphocytes. CD160 shows a broad specificity for binding to both classical and nonclassical MHC class I molecules. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased interferon-gamma secretion by NK cells and increased tumor growth/size following inoculation with NK-dependent B16 tumor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca7 G T 10: 80,013,743 E1921* probably null Het
Acnat2 G A 4: 49,380,484 T298I probably benign Het
Agbl4 T C 4: 110,955,663 probably null Het
Angpt2 T A 8: 18,699,133 T323S probably damaging Het
Ano2 A G 6: 125,807,847 K299R probably damaging Het
Armc2 G T 10: 41,917,187 Q814K probably benign Het
Atp9b A C 18: 80,858,626 I263S probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Casp12 T A 9: 5,352,204 H135Q probably benign Het
Ccdc180 A G 4: 45,914,225 I621V probably benign Het
Ctcfl A T 2: 173,112,360 C315S probably damaging Het
Egflam A G 15: 7,252,422 V411A probably benign Het
Ezh1 T C 11: 101,193,808 probably null Het
Fam171a1 T A 2: 3,225,317 S371T probably benign Het
Hspbap1 T G 16: 35,824,944 F333C probably damaging Het
Ky G C 9: 102,537,724 W278C probably damaging Het
Lrig3 T A 10: 126,007,014 probably null Het
Map3k6 A T 4: 133,247,128 S580C probably damaging Het
Mark2 T C 19: 7,277,425 T219A probably benign Het
Mbd5 A G 2: 49,258,144 I789V probably benign Het
Myo18a T A 11: 77,818,901 probably null Het
Nos1 A G 5: 117,923,395 T929A probably damaging Het
Olfr373 T A 8: 72,100,659 S300T probably benign Het
Olfr434 T C 6: 43,217,624 F237S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Palmd T C 3: 116,923,225 N541S possibly damaging Het
Pdzd2 A G 15: 12,373,087 S2321P probably damaging Het
Prdm8 T G 5: 98,183,502 I71S probably damaging Het
Prkg1 A C 19: 30,571,612 S654R probably benign Het
Psmf1 A T 2: 151,718,670 H260Q probably damaging Het
Rp1 A T 1: 4,352,290 I179N possibly damaging Het
Rreb1 A G 13: 37,948,891 K1681E probably benign Het
Rtn1 A T 12: 72,304,467 probably null Het
Scaf4 T A 16: 90,263,098 I37F unknown Het
Sema4c A G 1: 36,552,110 S383P probably damaging Het
Shc4 G T 2: 125,722,844 D178E probably benign Het
Slc2a5 A G 4: 150,142,179 N366S probably benign Het
Slc6a3 A G 13: 73,567,641 N465S probably benign Het
Tbc1d9b C A 11: 50,146,308 D261E probably benign Het
Tdrd3 A T 14: 87,487,239 T359S probably damaging Het
Thap3 T C 4: 151,983,331 M97V probably benign Het
Thg1l T A 11: 45,954,161 Q88L possibly damaging Het
Tjp3 T C 10: 81,273,823 T849A probably benign Het
Tomm70a G T 16: 57,142,817 D400Y probably damaging Het
Trak2 T C 1: 58,921,841 I177V probably benign Het
Trim66 T C 7: 109,475,454 I533M probably benign Het
Ush2a T A 1: 188,648,348 Y2285N probably benign Het
Ush2a C T 1: 188,864,639 P3859S probably damaging Het
Other mutations in Cd160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02102:Cd160 APN 3 96805570 missense possibly damaging 0.52
IGL02119:Cd160 APN 3 96808823 missense possibly damaging 0.96
IGL02306:Cd160 APN 3 96808823 missense possibly damaging 0.96
IGL02642:Cd160 APN 3 96800611 missense probably benign 0.01
IGL03056:Cd160 APN 3 96805811 missense probably benign 0.06
IGL03327:Cd160 APN 3 96805533 splice site probably null
R0690:Cd160 UTSW 3 96805786 missense probably damaging 0.99
R5669:Cd160 UTSW 3 96808898 start gained probably benign
R8076:Cd160 UTSW 3 96802346 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACTCACCTGTGACTAGAACGGAGAG -3'
(R):5'- AGAAGAGGCAGGCAGTGTCCTTAC -3'

Sequencing Primer
(F):5'- GTTCTATGGTGAACACCAACTGAG -3'
(R):5'- CAGTGTCCTTACTGTCATAGAAGC -3'
Posted On2014-01-05