Incidental Mutation 'R0993:Znrd1as'
ID97885
Institutional Source Beutler Lab
Gene Symbol Znrd1as
Ensembl Gene ENSMUSG00000036214
Gene Namezinc ribbon domain containing 1, antisense
Synonyms1700022C21Rik
MMRRC Submission 039113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R0993 (G1)
Quality Score117
Status Not validated
Chromosome17
Chromosomal Location36958592-36965625 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TCACCACCACCACCACCACCACCAC to TCACCACCACCACCACCACCAC at 36965047 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040177] [ENSMUST00000173814] [ENSMUST00000209623]
Predicted Effect probably benign
Transcript: ENSMUST00000040177
SMART Domains Protein: ENSMUSP00000048695
Gene: ENSMUSG00000036214

DomainStartEndE-ValueType
low complexity region 98 115 N/A INTRINSIC
coiled coil region 163 195 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172672
Predicted Effect probably benign
Transcript: ENSMUST00000173814
SMART Domains Protein: ENSMUSP00000134016
Gene: ENSMUSG00000036214

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
coiled coil region 84 116 N/A INTRINSIC
low complexity region 145 157 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185085
Predicted Effect probably benign
Transcript: ENSMUST00000209623
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Eml5 T C 12: 98,861,183 E596G probably benign Het
Eri3 C A 4: 117,564,663 T46K possibly damaging Het
Etv1 C T 12: 38,827,864 P68S probably damaging Het
Fbxl8 C A 8: 105,267,085 D24E probably damaging Het
Gm19965 A T 1: 116,821,825 N412I probably benign Het
Lmbr1 T A 5: 29,287,393 H66L probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1057 T G 2: 86,374,878 Y178S probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Samd8 T A 14: 21,775,495 V173D probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc2a9 T A 5: 38,382,063 T365S probably damaging Het
Slc32a1 T C 2: 158,611,420 M60T possibly damaging Het
Slx4 T C 16: 3,985,825 S1042G probably benign Het
Stard9 T C 2: 120,705,169 L193P probably damaging Het
Tln1 T C 4: 43,549,825 K529E probably benign Het
Vps13d G A 4: 145,117,692 R1342* probably null Het
Other mutations in Znrd1as
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Znrd1as APN 17 36964921 missense probably damaging 0.99
R0347:Znrd1as UTSW 17 36965315 missense probably damaging 1.00
R0789:Znrd1as UTSW 17 36964960 missense probably damaging 1.00
R2110:Znrd1as UTSW 17 36965444 missense possibly damaging 0.47
R2866:Znrd1as UTSW 17 36965160 missense possibly damaging 0.91
R4224:Znrd1as UTSW 17 36958725 utr 5 prime probably benign
R4746:Znrd1as UTSW 17 36964873 missense probably benign 0.00
R7449:Znrd1as UTSW 17 36964383 missense probably damaging 1.00
RF005:Znrd1as UTSW 17 36965048 small insertion probably benign
RF008:Znrd1as UTSW 17 36965054 small insertion probably benign
RF010:Znrd1as UTSW 17 36965063 small insertion probably benign
RF014:Znrd1as UTSW 17 36965060 small insertion probably benign
RF024:Znrd1as UTSW 17 36965057 small insertion probably benign
RF025:Znrd1as UTSW 17 36965048 small insertion probably benign
RF029:Znrd1as UTSW 17 36965071 small insertion probably benign
RF035:Znrd1as UTSW 17 36965066 small insertion probably benign
RF046:Znrd1as UTSW 17 36965057 small insertion probably benign
RF048:Znrd1as UTSW 17 36965059 small insertion probably benign
RF053:Znrd1as UTSW 17 36965066 small insertion probably benign
RF064:Znrd1as UTSW 17 36965050 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCATGAGGAGAGCAAAGCACTCTG -3'
(R):5'- AAGTTCCCTCCCTCGAATCATGCG -3'

Sequencing Primer
(F):5'- TCTGCAAGGAGCAAGCTAATTC -3'
(R):5'- TCCTCTAGCACAATTTTGGGTAG -3'
Posted On2014-01-05