Mutagenetix > Incidental Mutation

Incidental Mutation 'R1004:Xrcc5'

97894

Institutional Source

Beutler Lab

Gene Symbol

Xrcc5

Ensembl Gene

ENSMUSG00000026187

Gene Name

X-ray repair complementing defective repair in Chinese hamster cells 5

Synonyms

Ku86, Ku80

MMRRC Submission

039114-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1004 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

72307421-72394952 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 72383778 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027379 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027379]

AlphaFold

P27641

Predicted Effect

probably benign
Transcript: ENSMUST00000027379

SMART Domains

Protein: ENSMUSP00000027379
Gene: ENSMUSG00000026187

Domain	Start	End	E-Value	Type
VWA	7	245	8.07e-2	SMART
Ku78	302	441	8.9e-52	SMART
Pfam:Ku_C	476	570	6.9e-23	PFAM
Pfam:Ku_PK_bind	594	707	9.3e-31	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants are defective in DNA double-strand break repair and show impaired growth and severe combined immunodeficiency due to defective assembly of TCRs and immunoglobulins. Mutants die early with osteopenia, atrophic skin and hepatic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,151,954	I423T	possibly damaging	Het
Agbl3	A	T	6: 34,803,451	E453V	probably damaging	Het
Agxt	A	G	1: 93,135,699	M108V	possibly damaging	Het
Akap13	T	C	7: 75,687,286	I831T	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arid1a	A	G	4: 133,687,275	M1215T	unknown	Het
Cd163	G	T	6: 124,325,347	D957Y	probably damaging	Het
Ces2e	A	G	8: 104,929,738	D200G	probably damaging	Het
Cfap54	T	C	10: 93,066,696		probably benign	Het
Col11a1	A	G	3: 114,095,022		probably benign	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Dpp4	T	A	2: 62,332,640	Q754L	probably benign	Het
Ece1	A	G	4: 137,926,239	T100A	probably benign	Het
Gabbr2	C	T	4: 46,677,544	V779M	possibly damaging	Het
Gatm	C	T	2: 122,609,660		probably benign	Het
Gm20767	T	A	13: 120,155,022	D132E	probably benign	Het
Gpc2	A	G	5: 138,278,225	L213P	probably damaging	Het
Hook1	A	C	4: 96,022,287	N713H	probably benign	Het
Kdm5b	T	A	1: 134,588,904	I178K	possibly damaging	Het
Mettl9	G	A	7: 121,076,237	V287I	probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mycbp2	G	A	14: 103,140,917	T3774I	probably benign	Het
Nupl1	C	A	14: 60,247,481		probably benign	Het
Nxf1	A	T	19: 8,764,317	T119S	probably benign	Het
Oaz3	T	A	3: 94,435,043	H102L	probably damaging	Het
Olfr971	T	C	9: 39,839,980	F182S	probably benign	Het
Pfpl	A	T	19: 12,430,425	Q680L	probably benign	Het
Poli	T	A	18: 70,525,438	Q75L	probably benign	Het
Ppp2r3a	C	T	9: 101,198,630		probably null	Het
Prr30	A	G	14: 101,199,093	L11P	probably damaging	Het
Ptchd4	A	T	17: 42,377,602	Y345F	probably benign	Het
Ric1	A	G	19: 29,602,357	N1233S	probably benign	Het
Serpinb9f	TA	"TTTNA,T"	13: 33,334,242		probably benign	Het
Sh3bgrl2	C	T	9: 83,577,631		probably benign	Het
Skp1a	G	C	11: 52,237,380		probably benign	Het
Slc12a9	T	C	5: 137,322,524	K528R	probably damaging	Het
Slc22a6	A	G	19: 8,618,399	N35S	probably damaging	Het
Zfp235	T	A	7: 24,140,744	L266Q	probably damaging	Het
Zfp600	T	A	4: 146,196,533		probably benign	Het

Other mutations in Xrcc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01396:Xrcc5	APN	1	72354245	missense	probably benign	0.01
IGL01599:Xrcc5	APN	1	72346349	missense	possibly damaging	0.72
IGL01714:Xrcc5	APN	1	72329984	missense	probably damaging	0.98
IGL02740:Xrcc5	APN	1	72340081	critical splice donor site	probably null
IGL02884:Xrcc5	APN	1	72346237	missense	possibly damaging	0.95
barbarian	UTSW	1	72314178	missense	probably damaging	1.00
durio	UTSW	1	72339029	missense	probably damaging	1.00
Highlander	UTSW	1	72319127	missense	possibly damaging	0.55
monoculture	UTSW	1	72343030	missense	possibly damaging	0.82
xenophobe	UTSW	1	72312436	missense	probably damaging	1.00
zibethinus	UTSW	1	72310458	missense	probably damaging	1.00
PIT4362001:Xrcc5	UTSW	1	72393929	missense	probably benign
R0309:Xrcc5	UTSW	1	72307576	unclassified	probably benign
R0485:Xrcc5	UTSW	1	72338945	splice site	probably benign
R1421:Xrcc5	UTSW	1	72310477	missense	probably benign	0.00
R1530:Xrcc5	UTSW	1	72329944	missense	probably damaging	0.98
R1694:Xrcc5	UTSW	1	72319096	missense	possibly damaging	0.88
R1750:Xrcc5	UTSW	1	72325087	nonsense	probably null
R2037:Xrcc5	UTSW	1	72346370	missense	probably benign	0.01
R2296:Xrcc5	UTSW	1	72346326	missense	probably benign	0.00
R4299:Xrcc5	UTSW	1	72394720	makesense	probably null
R4388:Xrcc5	UTSW	1	72330030	missense	possibly damaging	0.46
R4527:Xrcc5	UTSW	1	72312500	missense	probably damaging	1.00
R4857:Xrcc5	UTSW	1	72326265	missense	possibly damaging	0.92
R5073:Xrcc5	UTSW	1	72339029	missense	probably damaging	1.00
R5233:Xrcc5	UTSW	1	72340050	missense	probably damaging	1.00
R5521:Xrcc5	UTSW	1	72346271	missense	probably damaging	1.00
R5996:Xrcc5	UTSW	1	72310458	missense	probably damaging	1.00
R6583:Xrcc5	UTSW	1	72312593	critical splice donor site	probably null
R6638:Xrcc5	UTSW	1	72383362	missense	possibly damaging	0.94
R6935:Xrcc5	UTSW	1	72343030	missense	possibly damaging	0.82
R7046:Xrcc5	UTSW	1	72394716	missense	probably benign	0.00
R7446:Xrcc5	UTSW	1	72393973	splice site	probably null
R7473:Xrcc5	UTSW	1	72312589	missense	probably damaging	1.00
R7875:Xrcc5	UTSW	1	72329931	missense	probably damaging	1.00
R7889:Xrcc5	UTSW	1	72356826	missense	probably benign	0.45
R8088:Xrcc5	UTSW	1	72312436	missense	probably damaging	1.00
R8179:Xrcc5	UTSW	1	72356857	missense	probably damaging	0.99
R8297:Xrcc5	UTSW	1	72325085	missense	possibly damaging	0.47
R8309:Xrcc5	UTSW	1	72319127	missense	possibly damaging	0.55
R8717:Xrcc5	UTSW	1	72383746	missense	probably benign
R8775:Xrcc5	UTSW	1	72393930	missense	probably benign	0.01
R8775-TAIL:Xrcc5	UTSW	1	72393930	missense	probably benign	0.01
R8798:Xrcc5	UTSW	1	72314178	missense	probably damaging	1.00
R8889:Xrcc5	UTSW	1	72343031	missense	possibly damaging	0.90
R8892:Xrcc5	UTSW	1	72343031	missense	possibly damaging	0.90
R9527:Xrcc5	UTSW	1	72329932	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTCCAGTTTTCAGAAGAACAGCG -3'
(R):5'- AGTTACTGAAGCCAGGACTACAGGTG -3'

Sequencing Primer
(F):5'- atgcatgtttgtatgtttgGGG -3'
(R):5'- CAGGACTACAGGTGGCTTC -3'

Posted On

2014-01-05