Incidental Mutation 'R1004:Xrcc5'
ID 97894
Institutional Source Beutler Lab
Gene Symbol Xrcc5
Ensembl Gene ENSMUSG00000026187
Gene Name X-ray repair complementing defective repair in Chinese hamster cells 5
Synonyms Ku86, Ku80
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1004 (G1)
Quality Score 211
Status Validated
Chromosome 1
Chromosomal Location 72307421-72394952 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 72383778 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027379]
AlphaFold P27641
Predicted Effect probably benign
Transcript: ENSMUST00000027379
SMART Domains Protein: ENSMUSP00000027379
Gene: ENSMUSG00000026187

DomainStartEndE-ValueType
VWA 7 245 8.07e-2 SMART
Ku78 302 441 8.9e-52 SMART
Pfam:Ku_C 476 570 6.9e-23 PFAM
Pfam:Ku_PK_bind 594 707 9.3e-31 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants are defective in DNA double-strand break repair and show impaired growth and severe combined immunodeficiency due to defective assembly of TCRs and immunoglobulins. Mutants die early with osteopenia, atrophic skin and hepatic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Xrcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Xrcc5 APN 1 72354245 missense probably benign 0.01
IGL01599:Xrcc5 APN 1 72346349 missense possibly damaging 0.72
IGL01714:Xrcc5 APN 1 72329984 missense probably damaging 0.98
IGL02740:Xrcc5 APN 1 72340081 critical splice donor site probably null
IGL02884:Xrcc5 APN 1 72346237 missense possibly damaging 0.95
barbarian UTSW 1 72314178 missense probably damaging 1.00
durio UTSW 1 72339029 missense probably damaging 1.00
Highlander UTSW 1 72319127 missense possibly damaging 0.55
R6935_Xrcc5_229 UTSW 1 72343030 missense possibly damaging 0.82
xenophobe UTSW 1 72312436 missense probably damaging 1.00
zibethinus UTSW 1 72310458 missense probably damaging 1.00
PIT4362001:Xrcc5 UTSW 1 72393929 missense probably benign
R0309:Xrcc5 UTSW 1 72307576 unclassified probably benign
R0485:Xrcc5 UTSW 1 72338945 splice site probably benign
R1421:Xrcc5 UTSW 1 72310477 missense probably benign 0.00
R1530:Xrcc5 UTSW 1 72329944 missense probably damaging 0.98
R1694:Xrcc5 UTSW 1 72319096 missense possibly damaging 0.88
R1750:Xrcc5 UTSW 1 72325087 nonsense probably null
R2037:Xrcc5 UTSW 1 72346370 missense probably benign 0.01
R2296:Xrcc5 UTSW 1 72346326 missense probably benign 0.00
R4299:Xrcc5 UTSW 1 72394720 makesense probably null
R4388:Xrcc5 UTSW 1 72330030 missense possibly damaging 0.46
R4527:Xrcc5 UTSW 1 72312500 missense probably damaging 1.00
R4857:Xrcc5 UTSW 1 72326265 missense possibly damaging 0.92
R5073:Xrcc5 UTSW 1 72339029 missense probably damaging 1.00
R5233:Xrcc5 UTSW 1 72340050 missense probably damaging 1.00
R5521:Xrcc5 UTSW 1 72346271 missense probably damaging 1.00
R5996:Xrcc5 UTSW 1 72310458 missense probably damaging 1.00
R6583:Xrcc5 UTSW 1 72312593 critical splice donor site probably null
R6638:Xrcc5 UTSW 1 72383362 missense possibly damaging 0.94
R6935:Xrcc5 UTSW 1 72343030 missense possibly damaging 0.82
R7046:Xrcc5 UTSW 1 72394716 missense probably benign 0.00
R7446:Xrcc5 UTSW 1 72393973 splice site probably null
R7473:Xrcc5 UTSW 1 72312589 missense probably damaging 1.00
R7875:Xrcc5 UTSW 1 72329931 missense probably damaging 1.00
R7889:Xrcc5 UTSW 1 72356826 missense probably benign 0.45
R8088:Xrcc5 UTSW 1 72312436 missense probably damaging 1.00
R8179:Xrcc5 UTSW 1 72356857 missense probably damaging 0.99
R8297:Xrcc5 UTSW 1 72325085 missense possibly damaging 0.47
R8309:Xrcc5 UTSW 1 72319127 missense possibly damaging 0.55
R8717:Xrcc5 UTSW 1 72383746 missense probably benign
R8775:Xrcc5 UTSW 1 72393930 missense probably benign 0.01
R8775-TAIL:Xrcc5 UTSW 1 72393930 missense probably benign 0.01
R8798:Xrcc5 UTSW 1 72314178 missense probably damaging 1.00
R8889:Xrcc5 UTSW 1 72343031 missense possibly damaging 0.90
R8892:Xrcc5 UTSW 1 72343031 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACCTCCAGTTTTCAGAAGAACAGCG -3'
(R):5'- AGTTACTGAAGCCAGGACTACAGGTG -3'

Sequencing Primer
(F):5'- atgcatgtttgtatgtttgGGG -3'
(R):5'- CAGGACTACAGGTGGCTTC -3'
Posted On 2014-01-05