Incidental Mutation 'R1004:Agxt'
ID 97896
Institutional Source Beutler Lab
Gene Symbol Agxt
Ensembl Gene ENSMUSG00000026272
Gene Name alanine-glyoxylate aminotransferase
Synonyms Agxt1, Agt1
MMRRC Submission 039114-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R1004 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 93135240-93145421 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93135699 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 108 (M108V)
Ref Sequence ENSEMBL: ENSMUSP00000027491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027491]
AlphaFold O35423
PDB Structure Crystal structure of Putative aminotransferase (AAH25799.1) from MUS MUSCULUS at 1.65 A resolution [X-RAY DIFFRACTION]
Crystal structure of Putative aminotransferase (AAH25799.1) from MUS MUSCULUS at 1.80 A resolution [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027491
AA Change: M108V

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027491
Gene: ENSMUSG00000026272
AA Change: M108V

DomainStartEndE-ValueType
Pfam:Aminotran_5 45 398 3.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191039
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed only in the liver and the encoded protein is localized mostly in the peroxisomes, where it is involved in glyoxylate detoxification. Mutations in this gene, some of which alter subcellular targetting, have been associated with type I primary hyperoxaluria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urinary oxalate levels and male mice suffer from bladder stones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Agxt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02375:Agxt APN 1 93135703 missense probably damaging 1.00
IGL02938:Agxt APN 1 93145109 missense probably damaging 1.00
R1511:Agxt UTSW 1 93135768 missense probably damaging 1.00
R1539:Agxt UTSW 1 93137979 missense probably damaging 0.98
R2049:Agxt UTSW 1 93137315 missense probably benign
R2407:Agxt UTSW 1 93135780 missense probably benign 0.25
R4910:Agxt UTSW 1 93135714 missense probably benign 0.01
R5013:Agxt UTSW 1 93142057 splice site probably benign
R5098:Agxt UTSW 1 93137307 missense probably benign 0.00
R6794:Agxt UTSW 1 93135382 missense possibly damaging 0.88
R7221:Agxt UTSW 1 93137901 missense possibly damaging 0.77
R8964:Agxt UTSW 1 93145147 missense possibly damaging 0.71
R9799:Agxt UTSW 1 93135348 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGGAGAAACAGGGACTCATCAAC -3'
(R):5'- TGCCTAGTCAGATGGAACAGGCAC -3'

Sequencing Primer
(F):5'- AGCAAGCCCCTGTCAGTTC -3'
(R):5'- GCACTGATCTGGTTGAGATACC -3'
Posted On 2014-01-05