Incidental Mutation 'R1099:Angpt2'
ID97907
Institutional Source Beutler Lab
Gene Symbol Angpt2
Ensembl Gene ENSMUSG00000031465
Gene Nameangiopoietin 2
SynonymsAng2, Ang-2
MMRRC Submission 039173-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R1099 (G1)
Quality Score218
Status Not validated
Chromosome8
Chromosomal Location18690263-18741562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18699133 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 323 (T323S)
Ref Sequence ENSEMBL: ENSMUSP00000033846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033846] [ENSMUST00000039412] [ENSMUST00000124910]
Predicted Effect probably damaging
Transcript: ENSMUST00000033846
AA Change: T323S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033846
Gene: ENSMUSG00000031465
AA Change: T323S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
coiled coil region 166 248 N/A INTRINSIC
FBG 279 494 9.43e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039412
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124910
SMART Domains Protein: ENSMUSP00000131698
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170200
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an endothelial cell (EC)-derived regulator of angiogenesis and ligand for endothelial-specific receptor tyrosine kinase. The encoded protein acts as an anti-apoptotic factor for stressed ECs and a proapoptotic factor for resting ECs. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous inactivation of this gene results in impaired angiogenesis, abnormal lymphatic development and function, and ultimately postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca7 G T 10: 80,013,743 E1921* probably null Het
Acnat2 G A 4: 49,380,484 T298I probably benign Het
Agbl4 T C 4: 110,955,663 probably null Het
Ano2 A G 6: 125,807,847 K299R probably damaging Het
Armc2 G T 10: 41,917,187 Q814K probably benign Het
Atp9b A C 18: 80,858,626 I263S probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Casp12 T A 9: 5,352,204 H135Q probably benign Het
Ccdc180 A G 4: 45,914,225 I621V probably benign Het
Cd160 G A 3: 96,805,840 A36V probably damaging Het
Ctcfl A T 2: 173,112,360 C315S probably damaging Het
Egflam A G 15: 7,252,422 V411A probably benign Het
Ezh1 T C 11: 101,193,808 probably null Het
Fam171a1 T A 2: 3,225,317 S371T probably benign Het
Hspbap1 T G 16: 35,824,944 F333C probably damaging Het
Ky G C 9: 102,537,724 W278C probably damaging Het
Lrig3 T A 10: 126,007,014 probably null Het
Map3k6 A T 4: 133,247,128 S580C probably damaging Het
Mark2 T C 19: 7,277,425 T219A probably benign Het
Mbd5 A G 2: 49,258,144 I789V probably benign Het
Myo18a T A 11: 77,818,901 probably null Het
Nos1 A G 5: 117,923,395 T929A probably damaging Het
Olfr373 T A 8: 72,100,659 S300T probably benign Het
Olfr434 T C 6: 43,217,624 F237S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Palmd T C 3: 116,923,225 N541S possibly damaging Het
Pdzd2 A G 15: 12,373,087 S2321P probably damaging Het
Prdm8 T G 5: 98,183,502 I71S probably damaging Het
Prkg1 A C 19: 30,571,612 S654R probably benign Het
Psmf1 A T 2: 151,718,670 H260Q probably damaging Het
Rp1 A T 1: 4,352,290 I179N possibly damaging Het
Rreb1 A G 13: 37,948,891 K1681E probably benign Het
Rtn1 A T 12: 72,304,467 probably null Het
Scaf4 T A 16: 90,263,098 I37F unknown Het
Sema4c A G 1: 36,552,110 S383P probably damaging Het
Shc4 G T 2: 125,722,844 D178E probably benign Het
Slc2a5 A G 4: 150,142,179 N366S probably benign Het
Slc6a3 A G 13: 73,567,641 N465S probably benign Het
Tbc1d9b C A 11: 50,146,308 D261E probably benign Het
Tdrd3 A T 14: 87,487,239 T359S probably damaging Het
Thap3 T C 4: 151,983,331 M97V probably benign Het
Thg1l T A 11: 45,954,161 Q88L possibly damaging Het
Tjp3 T C 10: 81,273,823 T849A probably benign Het
Tomm70a G T 16: 57,142,817 D400Y probably damaging Het
Trak2 T C 1: 58,921,841 I177V probably benign Het
Trim66 T C 7: 109,475,454 I533M probably benign Het
Ush2a C T 1: 188,864,639 P3859S probably damaging Het
Ush2a T A 1: 188,648,348 Y2285N probably benign Het
Other mutations in Angpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Angpt2 APN 8 18710528 missense probably benign 0.01
IGL01449:Angpt2 APN 8 18710625 missense probably benign 0.01
IGL03088:Angpt2 APN 8 18741023 missense probably benign 0.09
P0037:Angpt2 UTSW 8 18714243 unclassified probably benign
R0308:Angpt2 UTSW 8 18692125 missense possibly damaging 0.93
R1113:Angpt2 UTSW 8 18692118 nonsense probably null
R1264:Angpt2 UTSW 8 18741217 missense probably benign 0.00
R1308:Angpt2 UTSW 8 18692118 nonsense probably null
R1518:Angpt2 UTSW 8 18705839 missense probably benign 0.00
R1595:Angpt2 UTSW 8 18698113 missense probably damaging 1.00
R2016:Angpt2 UTSW 8 18705731 missense probably damaging 0.96
R2017:Angpt2 UTSW 8 18705731 missense probably damaging 0.96
R2050:Angpt2 UTSW 8 18705657 missense probably benign
R2142:Angpt2 UTSW 8 18714140 missense probably benign 0.39
R2184:Angpt2 UTSW 8 18692116 missense probably benign 0.00
R3028:Angpt2 UTSW 8 18703544 missense probably benign 0.01
R4096:Angpt2 UTSW 8 18698095 missense probably damaging 0.97
R4112:Angpt2 UTSW 8 18699123 missense probably damaging 1.00
R4738:Angpt2 UTSW 8 18741059 missense probably benign 0.07
R4790:Angpt2 UTSW 8 18714082 missense probably damaging 1.00
R4935:Angpt2 UTSW 8 18692115 missense probably damaging 1.00
R6056:Angpt2 UTSW 8 18698116 missense probably benign 0.00
R6499:Angpt2 UTSW 8 18694517 missense probably benign
R6938:Angpt2 UTSW 8 18698089 nonsense probably null
R7211:Angpt2 UTSW 8 18741131 missense probably benign
R7323:Angpt2 UTSW 8 18705824 missense probably benign 0.13
R7349:Angpt2 UTSW 8 18692074 missense probably damaging 0.99
R7746:Angpt2 UTSW 8 18692064 missense probably damaging 1.00
R7812:Angpt2 UTSW 8 18692145 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TGTGGAAGCCTGACAACAGAGC -3'
(R):5'- GCAACGATTCACTCCCCTGGTTAC -3'

Sequencing Primer
(F):5'- GTAACTTCTTCAGAAGCCATCGG -3'
(R):5'- TCCCCTGGTTACCACAGAG -3'
Posted On2014-01-05