Incidental Mutation 'R1004:Gatm'
ID97912
Institutional Source Beutler Lab
Gene Symbol Gatm
Ensembl Gene ENSMUSG00000027199
Gene Nameglycine amidinotransferase (L-arginine:glycine amidinotransferase)
Synonyms1810003P21Rik
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1004 (G1)
Quality Score164
Status Validated
Chromosome2
Chromosomal Location122594467-122611303 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 122609660 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028624]
Predicted Effect probably benign
Transcript: ENSMUST00000028624
SMART Domains Protein: ENSMUSP00000028624
Gene: ENSMUSG00000027199

DomainStartEndE-ValueType
Pfam:Amidinotransf 254 414 3e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme that belongs to the amidinotransferase family. This enzyme is involved in creatine biosynthesis, whereby it catalyzes the transfer of a guanido group from L-arginine to glycine, resulting in guanidinoacetic acid, the immediate precursor of creatine. Mutations in this gene cause arginine:glycine amidinotransferase deficiency, an inborn error of creatine synthesis characterized by mental retardation, language impairment, and behavioral disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance obesity, reduced adipocity and improved glucose homeostasis when fed a high fat diet. Mice homozygous for an ENU-induced allele exhibit increased susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Gatm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Gatm APN 2 122600825 missense possibly damaging 0.49
IGL03059:Gatm APN 2 122609700 missense probably damaging 1.00
mrbig UTSW 2 122600744 missense probably damaging 1.00
staggering UTSW 2 122595537 missense probably damaging 1.00
Weighted UTSW 2 122609660 splice site probably benign
R0046:Gatm UTSW 2 122600744 missense probably damaging 1.00
R0046:Gatm UTSW 2 122600744 missense probably damaging 1.00
R2088:Gatm UTSW 2 122598148 missense probably benign
R2128:Gatm UTSW 2 122600536 missense probably damaging 1.00
R4027:Gatm UTSW 2 122597446 missense probably damaging 1.00
R5155:Gatm UTSW 2 122609853 missense probably benign 0.04
R5183:Gatm UTSW 2 122595503 missense probably benign 0.01
R5517:Gatm UTSW 2 122595543 missense probably damaging 1.00
R5804:Gatm UTSW 2 122602602 missense probably benign 0.01
R5842:Gatm UTSW 2 122603627 missense probably benign
R6362:Gatm UTSW 2 122598196 missense probably benign 0.06
R8136:Gatm UTSW 2 122595537 missense probably damaging 1.00
R8199:Gatm UTSW 2 122602513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTGAGAGGTCCTGTGGCAATATC -3'
(R):5'- TGCAGCGAACTTTCCAGAGCAC -3'

Sequencing Primer
(F):5'- TCCTAAACTCCCAGGGAGG -3'
(R):5'- TTTCCAGAGCACCCAGGC -3'
Posted On2014-01-05