Incidental Mutation 'R1004:Oaz3'
ID 97916
Institutional Source Beutler Lab
Gene Symbol Oaz3
Ensembl Gene ENSMUSG00000028141
Gene Name ornithine decarboxylase antizyme 3
Synonyms AZ-3, Oaz-t, antizyme 3, AZ3, ornithine decarboxylase antizyme in testis
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock # R1004 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 94432414-94443915 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 94435043 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 102 (H102L)
Ref Sequence ENSEMBL: ENSMUSP00000145484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045245] [ENSMUST00000166032] [ENSMUST00000191506] [ENSMUST00000196606] [ENSMUST00000197495] [ENSMUST00000197901] [ENSMUST00000199678] [ENSMUST00000203883] [ENSMUST00000204548] [ENSMUST00000204913]
AlphaFold Q9R109
Predicted Effect probably damaging
Transcript: ENSMUST00000029787
AA Change: H99L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029787
Gene: ENSMUSG00000028141
AA Change: H99L

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
Pfam:ODC_AZ 88 186 3.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045245
SMART Domains Protein: ENSMUSP00000041002
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166032
SMART Domains Protein: ENSMUSP00000129635
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000191506
AA Change: H147L
SMART Domains Protein: ENSMUSP00000139408
Gene: ENSMUSG00000028141
AA Change: H147L

DomainStartEndE-ValueType
low complexity region 67 88 N/A INTRINSIC
Pfam:ODC_AZ 137 233 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196606
SMART Domains Protein: ENSMUSP00000143102
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 116 1.5e-11 SMART
KH 119 191 2.4e-17 SMART
TUDOR 348 406 1.7e-8 SMART
low complexity region 425 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196799
Predicted Effect probably benign
Transcript: ENSMUST00000197495
SMART Domains Protein: ENSMUSP00000143135
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 150 3e-18 SMART
TUDOR 307 365 1.7e-8 SMART
low complexity region 384 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197901
SMART Domains Protein: ENSMUSP00000142561
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199318
Predicted Effect probably damaging
Transcript: ENSMUST00000199678
AA Change: H147L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143080
Gene: ENSMUSG00000028141
AA Change: H147L

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
Pfam:ODC_AZ 90 186 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203883
AA Change: H102L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145484
Gene: ENSMUSG00000028141
AA Change: H102L

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:ODC_AZ 91 189 4.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204548
SMART Domains Protein: ENSMUSP00000145079
Gene: ENSMUSG00000028141

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204980
AA Change: H25L
Predicted Effect probably benign
Transcript: ENSMUST00000204913
SMART Domains Protein: ENSMUSP00000145113
Gene: ENSMUSG00000028141

DomainStartEndE-ValueType
low complexity region 71 89 N/A INTRINSIC
Meta Mutation Damage Score 0.2729 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 3, the third member of the antizyme family. Like antizymes 1 and 2, antizyme 3 inhibits ODC activity and polyamine uptake; however, it does not stimulate ODC degradation. Also, while antizymes 1 and 2 have broad tissue distribution, expression of antizyme 3 is restricted to haploid germ cells in testis, suggesting a distinct role for this antizyme in spermiogenesis. Antizyme 3 gene knockout studies showed that homozygous mutant male mice were infertile, and indicated the likely role of this antizyme in the formation of a rigid connection between the sperm head and tail during spermatogenesis. This transcript initiates translation from a non-AUG (CUG) codon that is highly conserved among the antizyme 3 orthologs. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to detachment of sperm tail and head during sperm maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Oaz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Oaz3 APN 3 94434980 missense probably benign 0.15
PIT4366001:Oaz3 UTSW 3 94433594 missense unknown
PIT4791001:Oaz3 UTSW 3 94433545 missense unknown
R1833:Oaz3 UTSW 3 94436042 unclassified probably benign
R2230:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R2231:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R2232:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R4487:Oaz3 UTSW 3 94435130 splice site probably null
R4776:Oaz3 UTSW 3 94434998 missense probably benign 0.00
R5502:Oaz3 UTSW 3 94435085 missense probably damaging 1.00
R5930:Oaz3 UTSW 3 94436410 missense possibly damaging 0.89
R6212:Oaz3 UTSW 3 94435068 missense probably benign 0.23
R6362:Oaz3 UTSW 3 94434988 missense probably damaging 0.99
R8247:Oaz3 UTSW 3 94436434 missense probably damaging 1.00
R8273:Oaz3 UTSW 3 94435127 missense probably damaging 1.00
R8537:Oaz3 UTSW 3 94436435 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGTCTAAGTCCAGCAACTGACCC -3'
(R):5'- AGCAAGATGACACCCTGAGCTTCC -3'

Sequencing Primer
(F):5'- GAACTGCAAGCTCTTGTCTG -3'
(R):5'- atctgcctgcctctgcc -3'
Posted On 2014-01-05