Mutagenetix > Incidental Mutation

Incidental Mutation 'R1004:Gabbr2'

97924

Institutional Source

Beutler Lab

Gene Symbol

Gabbr2

Ensembl Gene

ENSMUSG00000039809

Gene Name

gamma-aminobutyric acid (GABA) B receptor, 2

Synonyms

Gpr51, Gababr2, LOC242425

MMRRC Submission

039114-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R1004 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46662305-46991873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46677544 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 779 (V779M)

Ref Sequence

ENSEMBL: ENSMUSP00000103378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107749] [ENSMUST00000205643]

AlphaFold

Q80T41

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107749
AA Change: V779M

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: V779M

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
Pfam:Peripla_BP_6	59	434	1.5e-15	PFAM
Pfam:ANF_receptor	75	429	2e-51	PFAM
Pfam:7tm_3	492	745	6.4e-57	PFAM
PDB:4PAS\|B	778	818	1e-18	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129328

Predicted Effect

probably benign
Transcript: ENSMUST00000205643

Meta Mutation Damage Score

0.1089

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,151,954	I423T	possibly damaging	Het
Agbl3	A	T	6: 34,803,451	E453V	probably damaging	Het
Agxt	A	G	1: 93,135,699	M108V	possibly damaging	Het
Akap13	T	C	7: 75,687,286	I831T	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arid1a	A	G	4: 133,687,275	M1215T	unknown	Het
Cd163	G	T	6: 124,325,347	D957Y	probably damaging	Het
Ces2e	A	G	8: 104,929,738	D200G	probably damaging	Het
Cfap54	T	C	10: 93,066,696		probably benign	Het
Col11a1	A	G	3: 114,095,022		probably benign	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Dpp4	T	A	2: 62,332,640	Q754L	probably benign	Het
Ece1	A	G	4: 137,926,239	T100A	probably benign	Het
Gatm	C	T	2: 122,609,660		probably benign	Het
Gm20767	T	A	13: 120,155,022	D132E	probably benign	Het
Gpc2	A	G	5: 138,278,225	L213P	probably damaging	Het
Hook1	A	C	4: 96,022,287	N713H	probably benign	Het
Kdm5b	T	A	1: 134,588,904	I178K	possibly damaging	Het
Mettl9	G	A	7: 121,076,237	V287I	probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mycbp2	G	A	14: 103,140,917	T3774I	probably benign	Het
Nupl1	C	A	14: 60,247,481		probably benign	Het
Nxf1	A	T	19: 8,764,317	T119S	probably benign	Het
Oaz3	T	A	3: 94,435,043	H102L	probably damaging	Het
Olfr971	T	C	9: 39,839,980	F182S	probably benign	Het
Pfpl	A	T	19: 12,430,425	Q680L	probably benign	Het
Poli	T	A	18: 70,525,438	Q75L	probably benign	Het
Ppp2r3a	C	T	9: 101,198,630		probably null	Het
Prr30	A	G	14: 101,199,093	L11P	probably damaging	Het
Ptchd4	A	T	17: 42,377,602	Y345F	probably benign	Het
Ric1	A	G	19: 29,602,357	N1233S	probably benign	Het
Serpinb9f	TA	"TTTNA,T"	13: 33,334,242		probably benign	Het
Sh3bgrl2	C	T	9: 83,577,631		probably benign	Het
Skp1a	G	C	11: 52,237,380		probably benign	Het
Slc12a9	T	C	5: 137,322,524	K528R	probably damaging	Het
Slc22a6	A	G	19: 8,618,399	N35S	probably damaging	Het
Xrcc5	A	G	1: 72,383,778		probably benign	Het
Zfp235	T	A	7: 24,140,744	L266Q	probably damaging	Het
Zfp600	T	A	4: 146,196,533		probably benign	Het

Other mutations in Gabbr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Gabbr2	APN	4	46787600	missense	probably damaging	1.00
IGL00844:Gabbr2	APN	4	46875711	missense	probably damaging	1.00
IGL01584:Gabbr2	APN	4	46674524	missense	probably damaging	0.97
IGL01684:Gabbr2	APN	4	46736501	missense	probably benign
IGL01884:Gabbr2	APN	4	46875711	missense	probably damaging	1.00
IGL02073:Gabbr2	APN	4	46667547	missense	probably benign	0.00
IGL02376:Gabbr2	APN	4	46684300	missense	probably damaging	1.00
R0194:Gabbr2	UTSW	4	46787565	missense	possibly damaging	0.48
R0627:Gabbr2	UTSW	4	46681223	missense	possibly damaging	0.92
R0685:Gabbr2	UTSW	4	46787521	missense	possibly damaging	0.64
R0781:Gabbr2	UTSW	4	46718838	missense	probably damaging	1.00
R0882:Gabbr2	UTSW	4	46718904	missense	probably damaging	1.00
R0883:Gabbr2	UTSW	4	46677474	missense	probably benign	0.00
R1078:Gabbr2	UTSW	4	46664833	missense	probably damaging	0.99
R1110:Gabbr2	UTSW	4	46718838	missense	probably damaging	1.00
R1368:Gabbr2	UTSW	4	46674464	missense	probably benign	0.31
R1557:Gabbr2	UTSW	4	46846436	missense	probably damaging	1.00
R1577:Gabbr2	UTSW	4	46684319	missense	probably benign	0.29
R1645:Gabbr2	UTSW	4	46664963	splice site	probably null
R1743:Gabbr2	UTSW	4	46677603	missense	possibly damaging	0.47
R1848:Gabbr2	UTSW	4	46739823	missense	probably benign	0.31
R1997:Gabbr2	UTSW	4	46787502	missense	probably damaging	1.00
R2009:Gabbr2	UTSW	4	46734119	missense	probably damaging	1.00
R4021:Gabbr2	UTSW	4	46846435	missense	probably damaging	1.00
R4719:Gabbr2	UTSW	4	46718797	missense	probably damaging	0.99
R4757:Gabbr2	UTSW	4	46875675	missense	probably damaging	0.98
R4798:Gabbr2	UTSW	4	46991139	missense	possibly damaging	0.92
R5086:Gabbr2	UTSW	4	46724342	missense	probably damaging	1.00
R5176:Gabbr2	UTSW	4	46681208	missense	probably damaging	0.99
R5451:Gabbr2	UTSW	4	46684294	missense	probably benign	0.15
R5510:Gabbr2	UTSW	4	46734113	missense	probably damaging	1.00
R5611:Gabbr2	UTSW	4	46804105	missense	probably damaging	0.98
R6049:Gabbr2	UTSW	4	46787641	missense	probably damaging	1.00
R6089:Gabbr2	UTSW	4	46846448	missense	probably damaging	1.00
R6118:Gabbr2	UTSW	4	46736459	missense	probably damaging	1.00
R6209:Gabbr2	UTSW	4	46804069	missense	probably damaging	1.00
R6212:Gabbr2	UTSW	4	46681189	missense	probably damaging	0.98
R6717:Gabbr2	UTSW	4	46787574	missense	possibly damaging	0.50
R7339:Gabbr2	UTSW	4	46846340	missense	probably benign	0.01
R7479:Gabbr2	UTSW	4	46681166	missense	probably damaging	0.98
R7695:Gabbr2	UTSW	4	46875687	missense	probably damaging	1.00
R7808:Gabbr2	UTSW	4	46875744	missense	possibly damaging	0.49
R7832:Gabbr2	UTSW	4	46734096	missense	probably benign	0.04
R7993:Gabbr2	UTSW	4	46736349	splice site	probably null
R7994:Gabbr2	UTSW	4	46736349	splice site	probably null
R8051:Gabbr2	UTSW	4	46736349	splice site	probably null
R8084:Gabbr2	UTSW	4	46736349	splice site	probably null
R9050:Gabbr2	UTSW	4	46798659	missense	probably benign	0.03
R9187:Gabbr2	UTSW	4	46674533	missense	probably damaging	1.00
R9622:Gabbr2	UTSW	4	46724283	critical splice donor site	probably null
R9655:Gabbr2	UTSW	4	46815684	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- TCGGATGTGCTAAGCTCCCTGTTG -3'
(R):5'- AAGGCTGACTCTCCTATCCCAGAAG -3'

Sequencing Primer
(F):5'- AAGCTCCCTGTTGCCATGAC -3'
(R):5'- CTATCCCAGAAGGACTCTGAGG -3'

Posted On

2014-01-05