Incidental Mutation 'R1099:Ky'
ID97927
Institutional Source Beutler Lab
Gene Symbol Ky
Ensembl Gene ENSMUSG00000035606
Gene Namekyphoscoliosis peptidase
SynonymsD9Mgc44e
MMRRC Submission 039173-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R1099 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location102505750-102546239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 102537724 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 278 (W278C)
Ref Sequence ENSEMBL: ENSMUSP00000036032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039390]
Predicted Effect probably damaging
Transcript: ENSMUST00000039390
AA Change: W278C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036032
Gene: ENSMUSG00000035606
AA Change: W278C

DomainStartEndE-ValueType
TGc 217 285 1.9e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe degenerative myopathy involving postural muscles, resulting in thoraco-lumbar kyphoscoliosis with degenerative changes in intervertebral discs. Body weight is reduced and breathing is irregular. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca7 G T 10: 80,013,743 E1921* probably null Het
Acnat2 G A 4: 49,380,484 T298I probably benign Het
Agbl4 T C 4: 110,955,663 probably null Het
Angpt2 T A 8: 18,699,133 T323S probably damaging Het
Ano2 A G 6: 125,807,847 K299R probably damaging Het
Armc2 G T 10: 41,917,187 Q814K probably benign Het
Atp9b A C 18: 80,858,626 I263S probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Casp12 T A 9: 5,352,204 H135Q probably benign Het
Ccdc180 A G 4: 45,914,225 I621V probably benign Het
Cd160 G A 3: 96,805,840 A36V probably damaging Het
Ctcfl A T 2: 173,112,360 C315S probably damaging Het
Egflam A G 15: 7,252,422 V411A probably benign Het
Ezh1 T C 11: 101,193,808 probably null Het
Fam171a1 T A 2: 3,225,317 S371T probably benign Het
Hspbap1 T G 16: 35,824,944 F333C probably damaging Het
Lrig3 T A 10: 126,007,014 probably null Het
Map3k6 A T 4: 133,247,128 S580C probably damaging Het
Mark2 T C 19: 7,277,425 T219A probably benign Het
Mbd5 A G 2: 49,258,144 I789V probably benign Het
Myo18a T A 11: 77,818,901 probably null Het
Nos1 A G 5: 117,923,395 T929A probably damaging Het
Olfr373 T A 8: 72,100,659 S300T probably benign Het
Olfr434 T C 6: 43,217,624 F237S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Palmd T C 3: 116,923,225 N541S possibly damaging Het
Pdzd2 A G 15: 12,373,087 S2321P probably damaging Het
Prdm8 T G 5: 98,183,502 I71S probably damaging Het
Prkg1 A C 19: 30,571,612 S654R probably benign Het
Psmf1 A T 2: 151,718,670 H260Q probably damaging Het
Rp1 A T 1: 4,352,290 I179N possibly damaging Het
Rreb1 A G 13: 37,948,891 K1681E probably benign Het
Rtn1 A T 12: 72,304,467 probably null Het
Scaf4 T A 16: 90,263,098 I37F unknown Het
Sema4c A G 1: 36,552,110 S383P probably damaging Het
Shc4 G T 2: 125,722,844 D178E probably benign Het
Slc2a5 A G 4: 150,142,179 N366S probably benign Het
Slc6a3 A G 13: 73,567,641 N465S probably benign Het
Tbc1d9b C A 11: 50,146,308 D261E probably benign Het
Tdrd3 A T 14: 87,487,239 T359S probably damaging Het
Thap3 T C 4: 151,983,331 M97V probably benign Het
Thg1l T A 11: 45,954,161 Q88L possibly damaging Het
Tjp3 T C 10: 81,273,823 T849A probably benign Het
Tomm70a G T 16: 57,142,817 D400Y probably damaging Het
Trak2 T C 1: 58,921,841 I177V probably benign Het
Trim66 T C 7: 109,475,454 I533M probably benign Het
Ush2a T A 1: 188,648,348 Y2285N probably benign Het
Ush2a C T 1: 188,864,639 P3859S probably damaging Het
Other mutations in Ky
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01515:Ky APN 9 102542105 missense probably benign
IGL02197:Ky APN 9 102537786 missense possibly damaging 0.63
PIT4802001:Ky UTSW 9 102537773 missense probably benign 0.00
R0384:Ky UTSW 9 102542090 missense probably benign 0.05
R0620:Ky UTSW 9 102537621 missense probably benign 0.04
R1754:Ky UTSW 9 102541927 missense possibly damaging 0.54
R2075:Ky UTSW 9 102542746 missense probably damaging 0.98
R2322:Ky UTSW 9 102537791 critical splice donor site probably null
R2415:Ky UTSW 9 102541891 missense probably damaging 1.00
R3950:Ky UTSW 9 102542428 nonsense probably null
R4419:Ky UTSW 9 102542710 missense probably damaging 1.00
R4786:Ky UTSW 9 102541987 missense probably benign 0.02
R5261:Ky UTSW 9 102537599 critical splice acceptor site probably null
R5529:Ky UTSW 9 102542075 missense probably benign 0.10
R6857:Ky UTSW 9 102542432 missense probably damaging 1.00
R6931:Ky UTSW 9 102537627 missense probably damaging 1.00
R7205:Ky UTSW 9 102542292 missense probably damaging 1.00
R7211:Ky UTSW 9 102509150 missense probably benign 0.08
R7570:Ky UTSW 9 102542329 missense probably benign 0.00
R7642:Ky UTSW 9 102542270 missense probably benign 0.32
R7644:Ky UTSW 9 102537773 missense probably benign 0.00
R7910:Ky UTSW 9 102541942 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ACATCGGATCATGGCAAGCAGG -3'
(R):5'- ACTCATGGAGAGTCAGAGGAGTCAC -3'

Sequencing Primer
(F):5'- TTCAGAAGTAAGCTGAAGAGTCTC -3'
(R):5'- CGACCTGGAACCAGCTTTTG -3'
Posted On2014-01-05