Incidental Mutation 'R1099:Armc2'
ID97931
Institutional Source Beutler Lab
Gene Symbol Armc2
Ensembl Gene ENSMUSG00000071324
Gene Namearmadillo repeat containing 2
Synonyms
MMRRC Submission 039173-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1099 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location41914990-42018442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41917187 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 814 (Q814K)
Ref Sequence ENSEMBL: ENSMUSP00000125412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095729] [ENSMUST00000160262] [ENSMUST00000161927]
Predicted Effect probably benign
Transcript: ENSMUST00000095729
AA Change: Q814K

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093397
Gene: ENSMUSG00000071324
AA Change: Q814K

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 222 237 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 324 336 N/A INTRINSIC
ARM 355 393 7.53e1 SMART
ARM 400 453 3.69e1 SMART
ARM 454 496 8.23e1 SMART
Blast:ARM 497 540 1e-16 BLAST
Blast:ARM 542 603 1e-6 BLAST
Blast:ARM 603 649 7e-20 BLAST
Blast:ARM 653 692 3e-8 BLAST
ARM 693 733 4.41e1 SMART
ARM 734 777 2.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105503
Predicted Effect probably benign
Transcript: ENSMUST00000160262
AA Change: Q814K

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125412
Gene: ENSMUSG00000071324
AA Change: Q814K

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 222 237 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 324 336 N/A INTRINSIC
ARM 355 393 7.53e1 SMART
ARM 400 453 3.69e1 SMART
ARM 454 496 8.23e1 SMART
Blast:ARM 497 540 1e-16 BLAST
Blast:ARM 542 603 1e-6 BLAST
Blast:ARM 603 649 7e-20 BLAST
Blast:ARM 653 692 3e-8 BLAST
ARM 693 733 4.41e1 SMART
ARM 734 777 2.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160367
Predicted Effect probably benign
Transcript: ENSMUST00000161927
SMART Domains Protein: ENSMUSP00000124049
Gene: ENSMUSG00000071324

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca7 G T 10: 80,013,743 E1921* probably null Het
Acnat2 G A 4: 49,380,484 T298I probably benign Het
Agbl4 T C 4: 110,955,663 probably null Het
Angpt2 T A 8: 18,699,133 T323S probably damaging Het
Ano2 A G 6: 125,807,847 K299R probably damaging Het
Atp9b A C 18: 80,858,626 I263S probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Casp12 T A 9: 5,352,204 H135Q probably benign Het
Ccdc180 A G 4: 45,914,225 I621V probably benign Het
Cd160 G A 3: 96,805,840 A36V probably damaging Het
Ctcfl A T 2: 173,112,360 C315S probably damaging Het
Egflam A G 15: 7,252,422 V411A probably benign Het
Ezh1 T C 11: 101,193,808 probably null Het
Fam171a1 T A 2: 3,225,317 S371T probably benign Het
Hspbap1 T G 16: 35,824,944 F333C probably damaging Het
Ky G C 9: 102,537,724 W278C probably damaging Het
Lrig3 T A 10: 126,007,014 probably null Het
Map3k6 A T 4: 133,247,128 S580C probably damaging Het
Mark2 T C 19: 7,277,425 T219A probably benign Het
Mbd5 A G 2: 49,258,144 I789V probably benign Het
Myo18a T A 11: 77,818,901 probably null Het
Nos1 A G 5: 117,923,395 T929A probably damaging Het
Olfr373 T A 8: 72,100,659 S300T probably benign Het
Olfr434 T C 6: 43,217,624 F237S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Palmd T C 3: 116,923,225 N541S possibly damaging Het
Pdzd2 A G 15: 12,373,087 S2321P probably damaging Het
Prdm8 T G 5: 98,183,502 I71S probably damaging Het
Prkg1 A C 19: 30,571,612 S654R probably benign Het
Psmf1 A T 2: 151,718,670 H260Q probably damaging Het
Rp1 A T 1: 4,352,290 I179N possibly damaging Het
Rreb1 A G 13: 37,948,891 K1681E probably benign Het
Rtn1 A T 12: 72,304,467 probably null Het
Scaf4 T A 16: 90,263,098 I37F unknown Het
Sema4c A G 1: 36,552,110 S383P probably damaging Het
Shc4 G T 2: 125,722,844 D178E probably benign Het
Slc2a5 A G 4: 150,142,179 N366S probably benign Het
Slc6a3 A G 13: 73,567,641 N465S probably benign Het
Tbc1d9b C A 11: 50,146,308 D261E probably benign Het
Tdrd3 A T 14: 87,487,239 T359S probably damaging Het
Thap3 T C 4: 151,983,331 M97V probably benign Het
Thg1l T A 11: 45,954,161 Q88L possibly damaging Het
Tjp3 T C 10: 81,273,823 T849A probably benign Het
Tomm70a G T 16: 57,142,817 D400Y probably damaging Het
Trak2 T C 1: 58,921,841 I177V probably benign Het
Trim66 T C 7: 109,475,454 I533M probably benign Het
Ush2a T A 1: 188,648,348 Y2285N probably benign Het
Ush2a C T 1: 188,864,639 P3859S probably damaging Het
Other mutations in Armc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:Armc2 UTSW 10 41947887 splice site probably benign
R0144:Armc2 UTSW 10 41947887 splice site probably benign
R0427:Armc2 UTSW 10 42000410 missense possibly damaging 0.87
R0540:Armc2 UTSW 10 41922695 missense probably benign 0.11
R0561:Armc2 UTSW 10 41993192 missense probably benign 0.02
R0607:Armc2 UTSW 10 41922695 missense probably benign 0.11
R1130:Armc2 UTSW 10 42011834 missense possibly damaging 0.85
R2116:Armc2 UTSW 10 41963667 missense probably damaging 0.98
R2870:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2870:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2871:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2871:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2872:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2872:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2873:Armc2 UTSW 10 41966700 critical splice donor site probably null
R3083:Armc2 UTSW 10 41966730 missense probably damaging 1.00
R3771:Armc2 UTSW 10 41922227 missense probably damaging 1.00
R3784:Armc2 UTSW 10 41922194 missense probably benign 0.08
R3880:Armc2 UTSW 10 41963725 missense possibly damaging 0.71
R4024:Armc2 UTSW 10 41993058 missense probably benign
R4155:Armc2 UTSW 10 42011867 missense probably damaging 0.96
R4370:Armc2 UTSW 10 41917200 missense probably benign 0.13
R4378:Armc2 UTSW 10 41993082 missense possibly damaging 0.66
R4896:Armc2 UTSW 10 41923794 missense probably damaging 1.00
R5119:Armc2 UTSW 10 41922148 missense probably damaging 1.00
R5159:Armc2 UTSW 10 42008715 missense probably damaging 0.96
R5517:Armc2 UTSW 10 41963850 missense probably benign 0.29
R5640:Armc2 UTSW 10 42011898 missense possibly damaging 0.87
R5767:Armc2 UTSW 10 42011927 missense probably benign 0.02
R5965:Armc2 UTSW 10 41922572 missense possibly damaging 0.94
R6897:Armc2 UTSW 10 41993229 critical splice acceptor site probably null
R7233:Armc2 UTSW 10 41923804 missense probably damaging 1.00
R7829:Armc2 UTSW 10 41926860 missense probably benign
R7832:Armc2 UTSW 10 41966796 missense probably damaging 1.00
R7915:Armc2 UTSW 10 41966796 missense probably damaging 1.00
R7999:Armc2 UTSW 10 42011958 missense not run
R8029:Armc2 UTSW 10 41927000 missense not run
R8030:Armc2 UTSW 10 41966742 missense not run
R8033:Armc2 UTSW 10 42008684 missense not run
Z1176:Armc2 UTSW 10 41927044 missense not run
Z1176:Armc2 UTSW 10 41963656 missense not run
Predicted Primers PCR Primer
(F):5'- TTGCTCACTCCAAGGTTGTCACTG -3'
(R):5'- TCATGGCGATATTAAAGGTGACCCG -3'

Sequencing Primer
(F):5'- ACCATTTCCTGAGCGTGAG -3'
(R):5'- TTGTGCAGTCACATGCCA -3'
Posted On2014-01-05