Mutagenetix > Incidental Mutations

Incidental Mutation 'R1004:Ece1'

97934

Institutional Source

Beutler Lab

Gene Symbol

Ece1

Ensembl Gene

ENSMUSG00000057530

Gene Name

endothelin converting enzyme 1

Synonyms

MMRRC Submission

039114-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.716) question?

Stock #

R1004 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

137862237-137965229 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 137926239 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 100 (T100A)

Ref Sequence

ENSEMBL: ENSMUSP00000114671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102518] [ENSMUST00000151110]

Predicted Effect

probably benign
Transcript: ENSMUST00000102518
AA Change: T84A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000099576
Gene: ENSMUSG00000057530
AA Change: T84A

Domain	Start	End	E-Value	Type
transmembrane domain	52	74	N/A	INTRINSIC
Pfam:Peptidase_M13_N	105	490	1.2e-112	PFAM
Pfam:Peptidase_M13	549	752	1.8e-77	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129607

Predicted Effect

probably benign
Transcript: ENSMUST00000151110
AA Change: T100A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000114671
Gene: ENSMUSG00000057530
AA Change: T100A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
transmembrane domain	68	90	N/A	INTRINSIC
Pfam:Peptidase_M13_N	121	206	1.4e-29	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations show cardiac and craniofacial abnormalities and embryonic mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,151,954	I423T	possibly damaging	Het
Agbl3	A	T	6: 34,803,451	E453V	probably damaging	Het
Agxt	A	G	1: 93,135,699	M108V	possibly damaging	Het
Akap13	T	C	7: 75,687,286	I831T	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arid1a	A	G	4: 133,687,275	M1215T	unknown	Het
Cd163	G	T	6: 124,325,347	D957Y	probably damaging	Het
Ces2e	A	G	8: 104,929,738	D200G	probably damaging	Het
Cfap54	T	C	10: 93,066,696		probably benign	Het
Col11a1	A	G	3: 114,095,022		probably benign	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Dpp4	T	A	2: 62,332,640	Q754L	probably benign	Het
Gabbr2	C	T	4: 46,677,544	V779M	possibly damaging	Het
Gatm	C	T	2: 122,609,660		probably benign	Het
Gm20767	T	A	13: 120,155,022	D132E	probably benign	Het
Gpc2	A	G	5: 138,278,225	L213P	probably damaging	Het
Hook1	A	C	4: 96,022,287	N713H	probably benign	Het
Kdm5b	T	A	1: 134,588,904	I178K	possibly damaging	Het
Mettl9	G	A	7: 121,076,237	V287I	probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mycbp2	G	A	14: 103,140,917	T3774I	probably benign	Het
Nupl1	C	A	14: 60,247,481		probably benign	Het
Nxf1	A	T	19: 8,764,317	T119S	probably benign	Het
Oaz3	T	A	3: 94,435,043	H102L	probably damaging	Het
Olfr971	T	C	9: 39,839,980	F182S	probably benign	Het
Pfpl	A	T	19: 12,430,425	Q680L	probably benign	Het
Poli	T	A	18: 70,525,438	Q75L	probably benign	Het
Ppp2r3a	C	T	9: 101,198,630		probably null	Het
Prr30	A	G	14: 101,199,093	L11P	probably damaging	Het
Ptchd4	A	T	17: 42,377,602	Y345F	probably benign	Het
Ric1	A	G	19: 29,602,357	N1233S	probably benign	Het
Serpinb9f	TA	"TTTNA,T"	13: 33,334,242		probably benign	Het
Sh3bgrl2	C	T	9: 83,577,631		probably benign	Het
Skp1a	G	C	11: 52,237,380		probably benign	Het
Slc12a9	T	C	5: 137,322,524	K528R	probably damaging	Het
Slc22a6	A	G	19: 8,618,399	N35S	probably damaging	Het
Xrcc5	A	G	1: 72,383,778		probably benign	Het
Zfp235	T	A	7: 24,140,744	L266Q	probably damaging	Het
Zfp600	T	A	4: 146,196,533		probably benign	Het

Other mutations in Ece1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Ece1	APN	4	137938658	missense	probably damaging	1.00
IGL01538:Ece1	APN	4	137948544	missense	probably benign
IGL01588:Ece1	APN	4	137957206	splice site	probably benign
IGL01678:Ece1	APN	4	137962733	missense	probably damaging	1.00
IGL02619:Ece1	APN	4	137938733	missense	probably benign	0.08
IGL02936:Ece1	APN	4	137946301	missense	probably benign	0.01
IGL02956:Ece1	APN	4	137962838	missense	probably damaging	0.99
IGL03332:Ece1	APN	4	137946355	missense	probably damaging	0.99
R0063:Ece1	UTSW	4	137948581	missense	probably benign	0.14
R0240:Ece1	UTSW	4	137949435	splice site	probably benign
R1515:Ece1	UTSW	4	137951508	missense	probably benign	0.00
R1541:Ece1	UTSW	4	137948660	splice site	probably null
R1796:Ece1	UTSW	4	137958001	missense	probably damaging	1.00
R1834:Ece1	UTSW	4	137958001	missense	probably damaging	1.00
R1834:Ece1	UTSW	4	137958128	missense	probably damaging	0.99
R1836:Ece1	UTSW	4	137958001	missense	probably damaging	1.00
R1930:Ece1	UTSW	4	137938763	missense	probably benign	0.01
R1931:Ece1	UTSW	4	137938763	missense	probably benign	0.01
R2065:Ece1	UTSW	4	137958082	missense	probably benign	0.04
R2281:Ece1	UTSW	4	137946362	missense	possibly damaging	0.93
R3118:Ece1	UTSW	4	137948544	missense	probably benign
R4720:Ece1	UTSW	4	137957175	missense	probably damaging	1.00
R4773:Ece1	UTSW	4	137945153	missense	probably benign	0.00
R5794:Ece1	UTSW	4	137956533	missense	probably damaging	0.99
R5969:Ece1	UTSW	4	137961740	critical splice donor site	probably null
R6056:Ece1	UTSW	4	137961647	missense	probably damaging	1.00
R6332:Ece1	UTSW	4	137958008	missense	probably damaging	1.00
R6648:Ece1	UTSW	4	137921159	missense	probably benign	0.00
R7285:Ece1	UTSW	4	137913763	splice site	probably null
R7387:Ece1	UTSW	4	137938784	missense	possibly damaging	0.69
R8103:Ece1	UTSW	4	137913822	missense	probably benign
R8294:Ece1	UTSW	4	137948620	missense	possibly damaging	0.60
R8308:Ece1	UTSW	4	137936764	missense	probably damaging	0.99
X0063:Ece1	UTSW	4	137926375	missense	probably damaging	0.97
Z1176:Ece1	UTSW	4	137921027	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- GGAACCACGGAACGGAGTTTACAC -3'
(R):5'- CCTTTGTCGCTTACCCAGTAGATGC -3'

Sequencing Primer
(F):5'- ACAGCTAATAGAAGTCCTGTGTG -3'
(R):5'- ACCCAGTAGATGCTTGATGAC -3'

Posted On

2014-01-05