Incidental Mutation 'R1099:Tjp3'
ID97935
Institutional Source Beutler Lab
Gene Symbol Tjp3
Ensembl Gene ENSMUSG00000034917
Gene Nametight junction protein 3
SynonymsZO-3
MMRRC Submission 039173-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1099 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location81273207-81291581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81273823 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 849 (T849A)
Ref Sequence ENSEMBL: ENSMUSP00000151601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045744] [ENSMUST00000057798] [ENSMUST00000218742] [ENSMUST00000219304] [ENSMUST00000219460] [ENSMUST00000219479] [ENSMUST00000220297]
Predicted Effect probably benign
Transcript: ENSMUST00000045744
AA Change: T849A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036438
Gene: ENSMUSG00000034917
AA Change: T849A

DomainStartEndE-ValueType
PDZ 20 93 2.81e-18 SMART
low complexity region 119 162 N/A INTRINSIC
PDZ 196 264 2.71e-11 SMART
low complexity region 297 305 N/A INTRINSIC
PDZ 378 451 4.97e-19 SMART
SH3 466 539 9.96e-2 SMART
low complexity region 548 559 N/A INTRINSIC
GuKc 570 756 6.9e-46 SMART
Blast:GuKc 767 898 9e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000057798
SMART Domains Protein: ENSMUSP00000050995
Gene: ENSMUSG00000004931

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
PTB 213 359 3.03e-40 SMART
PDZ 400 478 3.74e-14 SMART
PDZ 492 557 9.58e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218146
Predicted Effect probably benign
Transcript: ENSMUST00000218297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218520
Predicted Effect probably benign
Transcript: ENSMUST00000218742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219294
Predicted Effect probably benign
Transcript: ENSMUST00000219304
Predicted Effect probably benign
Transcript: ENSMUST00000219460
Predicted Effect probably benign
Transcript: ENSMUST00000219479
AA Change: T849A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219919
Predicted Effect probably benign
Transcript: ENSMUST00000220297
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase-like (MAGUK) protein family which is characterized by members having multiple PDZ domains, a single SH3 domain, and a single guanylate kinase-like (GUK)-domain. In addition, members of the zonula occludens protein subfamily have an acidic domain, a basic arginine-rich region, and a proline-rich domain. The protein encoded by this gene plays a role in the linkage between the actin cytoskeleton and tight-junctions and also sequesters cyclin D1 at tight junctions during mitosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. This gene has a partial pseudogene on chromosome 1. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutation of this gene results in viable and fertile mice with no abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca7 G T 10: 80,013,743 E1921* probably null Het
Acnat2 G A 4: 49,380,484 T298I probably benign Het
Agbl4 T C 4: 110,955,663 probably null Het
Angpt2 T A 8: 18,699,133 T323S probably damaging Het
Ano2 A G 6: 125,807,847 K299R probably damaging Het
Armc2 G T 10: 41,917,187 Q814K probably benign Het
Atp9b A C 18: 80,858,626 I263S probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Casp12 T A 9: 5,352,204 H135Q probably benign Het
Ccdc180 A G 4: 45,914,225 I621V probably benign Het
Cd160 G A 3: 96,805,840 A36V probably damaging Het
Ctcfl A T 2: 173,112,360 C315S probably damaging Het
Egflam A G 15: 7,252,422 V411A probably benign Het
Ezh1 T C 11: 101,193,808 probably null Het
Fam171a1 T A 2: 3,225,317 S371T probably benign Het
Hspbap1 T G 16: 35,824,944 F333C probably damaging Het
Ky G C 9: 102,537,724 W278C probably damaging Het
Lrig3 T A 10: 126,007,014 probably null Het
Map3k6 A T 4: 133,247,128 S580C probably damaging Het
Mark2 T C 19: 7,277,425 T219A probably benign Het
Mbd5 A G 2: 49,258,144 I789V probably benign Het
Myo18a T A 11: 77,818,901 probably null Het
Nos1 A G 5: 117,923,395 T929A probably damaging Het
Olfr373 T A 8: 72,100,659 S300T probably benign Het
Olfr434 T C 6: 43,217,624 F237S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Palmd T C 3: 116,923,225 N541S possibly damaging Het
Pdzd2 A G 15: 12,373,087 S2321P probably damaging Het
Prdm8 T G 5: 98,183,502 I71S probably damaging Het
Prkg1 A C 19: 30,571,612 S654R probably benign Het
Psmf1 A T 2: 151,718,670 H260Q probably damaging Het
Rp1 A T 1: 4,352,290 I179N possibly damaging Het
Rreb1 A G 13: 37,948,891 K1681E probably benign Het
Rtn1 A T 12: 72,304,467 probably null Het
Scaf4 T A 16: 90,263,098 I37F unknown Het
Sema4c A G 1: 36,552,110 S383P probably damaging Het
Shc4 G T 2: 125,722,844 D178E probably benign Het
Slc2a5 A G 4: 150,142,179 N366S probably benign Het
Slc6a3 A G 13: 73,567,641 N465S probably benign Het
Tbc1d9b C A 11: 50,146,308 D261E probably benign Het
Tdrd3 A T 14: 87,487,239 T359S probably damaging Het
Thap3 T C 4: 151,983,331 M97V probably benign Het
Thg1l T A 11: 45,954,161 Q88L possibly damaging Het
Tomm70a G T 16: 57,142,817 D400Y probably damaging Het
Trak2 T C 1: 58,921,841 I177V probably benign Het
Trim66 T C 7: 109,475,454 I533M probably benign Het
Ush2a T A 1: 188,648,348 Y2285N probably benign Het
Ush2a C T 1: 188,864,639 P3859S probably damaging Het
Other mutations in Tjp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Tjp3 APN 10 81273865 missense probably benign
IGL01739:Tjp3 APN 10 81278656 missense probably benign 0.09
IGL02826:Tjp3 APN 10 81273689 missense probably damaging 0.98
IGL03145:Tjp3 APN 10 81283688 missense probably benign 0.05
PIT4480001:Tjp3 UTSW 10 81279257 missense probably damaging 1.00
R0561:Tjp3 UTSW 10 81273840 missense probably benign
R0562:Tjp3 UTSW 10 81280555 missense probably damaging 0.99
R1618:Tjp3 UTSW 10 81276260 unclassified probably benign
R1786:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R1955:Tjp3 UTSW 10 81277999 missense probably damaging 1.00
R2107:Tjp3 UTSW 10 81280544 missense possibly damaging 0.67
R2130:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2131:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2132:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2133:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2178:Tjp3 UTSW 10 81280107 missense probably benign 0.17
R3054:Tjp3 UTSW 10 81280507 missense probably benign 0.13
R3055:Tjp3 UTSW 10 81280507 missense probably benign 0.13
R5470:Tjp3 UTSW 10 81279547 missense probably benign 0.04
R5645:Tjp3 UTSW 10 81278620 splice site probably null
R5918:Tjp3 UTSW 10 81277912 missense probably benign 0.01
R6108:Tjp3 UTSW 10 81281146 missense probably benign
R6245:Tjp3 UTSW 10 81277276 missense probably benign 0.02
R6300:Tjp3 UTSW 10 81281117 nonsense probably null
R7686:Tjp3 UTSW 10 81278051 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGGGTTGGGACTTGAAACTCCTTC -3'
(R):5'- CATTCAGAGTATGGACCTCGGCTTC -3'

Sequencing Primer
(F):5'- GTTGGGACTTGAAACTCCTTCATATC -3'
(R):5'- CGGCTTCCCTTGAGATTACAATATAC -3'
Posted On2014-01-05