Incidental Mutation 'R1004:Slc12a9'
ID97938
Institutional Source Beutler Lab
Gene Symbol Slc12a9
Ensembl Gene ENSMUSG00000037344
Gene Namesolute carrier family 12 (potassium/chloride transporters), member 9
SynonymsCIP1
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R1004 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137314558-137333597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137322524 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 528 (K528R)
Ref Sequence ENSEMBL: ENSMUSP00000038106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039991]
Predicted Effect probably damaging
Transcript: ENSMUST00000039991
AA Change: K528R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038106
Gene: ENSMUSG00000037344
AA Change: K528R

DomainStartEndE-ValueType
Pfam:AA_permease 42 536 1.8e-114 PFAM
Pfam:SLC12 545 639 4.6e-13 PFAM
low complexity region 804 817 N/A INTRINSIC
low complexity region 845 866 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141517
Meta Mutation Damage Score 0.5719 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Slc12a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Slc12a9 APN 5 137322842 missense probably damaging 0.97
IGL01288:Slc12a9 APN 5 137330938 splice site probably null
IGL01829:Slc12a9 APN 5 137327365 splice site probably benign
IGL02379:Slc12a9 APN 5 137321429 missense probably damaging 0.99
IGL02975:Slc12a9 APN 5 137322443 missense probably damaging 1.00
R0145:Slc12a9 UTSW 5 137315288 missense probably damaging 1.00
R0325:Slc12a9 UTSW 5 137322846 missense probably damaging 1.00
R0645:Slc12a9 UTSW 5 137315376 missense probably benign 0.01
R1646:Slc12a9 UTSW 5 137323149 missense probably damaging 1.00
R2280:Slc12a9 UTSW 5 137332212 missense probably damaging 0.99
R2425:Slc12a9 UTSW 5 137315597 missense probably damaging 1.00
R2909:Slc12a9 UTSW 5 137332201 missense probably benign
R3617:Slc12a9 UTSW 5 137332497 missense probably damaging 1.00
R4255:Slc12a9 UTSW 5 137321432 missense probably damaging 0.99
R4431:Slc12a9 UTSW 5 137321513 missense probably benign 0.05
R5384:Slc12a9 UTSW 5 137331014 missense probably damaging 1.00
R5665:Slc12a9 UTSW 5 137321403 missense possibly damaging 0.79
R6682:Slc12a9 UTSW 5 137327401 missense probably damaging 1.00
R6778:Slc12a9 UTSW 5 137315081 missense possibly damaging 0.85
R6977:Slc12a9 UTSW 5 137315813 missense probably damaging 1.00
R7366:Slc12a9 UTSW 5 137328623 nonsense probably null
R7489:Slc12a9 UTSW 5 137322820 missense probably damaging 0.96
R7491:Slc12a9 UTSW 5 137322820 missense probably damaging 0.96
R7844:Slc12a9 UTSW 5 137332186 missense probably damaging 1.00
R7955:Slc12a9 UTSW 5 137325546 missense probably damaging 1.00
R8350:Slc12a9 UTSW 5 137315475 missense probably benign 0.06
R8351:Slc12a9 UTSW 5 137315475 missense probably benign 0.06
R8351:Slc12a9 UTSW 5 137328448 missense probably benign
R8352:Slc12a9 UTSW 5 137315475 missense probably benign 0.06
R8393:Slc12a9 UTSW 5 137321436 missense probably damaging 1.00
R8450:Slc12a9 UTSW 5 137315475 missense probably benign 0.06
R8451:Slc12a9 UTSW 5 137315475 missense probably benign 0.06
R8451:Slc12a9 UTSW 5 137328448 missense probably benign
R8452:Slc12a9 UTSW 5 137315475 missense probably benign 0.06
RF017:Slc12a9 UTSW 5 137325550 missense probably damaging 1.00
Z1177:Slc12a9 UTSW 5 137322437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAGATAGTCACTCACCAAGGTC -3'
(R):5'- GGAAGCTCAACACATTGGCTGC -3'

Sequencing Primer
(F):5'- AGGTCTCCCAGAGTGACATGG -3'
(R):5'- ATGTCAGCCAAGCCTTGC -3'
Posted On2014-01-05