Incidental Mutation 'R1004:Gpc2'
ID97940
Institutional Source Beutler Lab
Gene Symbol Gpc2
Ensembl Gene ENSMUSG00000029510
Gene Nameglypican 2 (cerebroglycan)
Synonyms
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1004 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138273655-138280005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138278225 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 213 (L213P)
Ref Sequence ENSEMBL: ENSMUSP00000137879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014089] [ENSMUST00000048028] [ENSMUST00000159067] [ENSMUST00000160729] [ENSMUST00000161691] [ENSMUST00000161827] [ENSMUST00000161984] [ENSMUST00000162245]
Predicted Effect probably damaging
Transcript: ENSMUST00000014089
AA Change: L213P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014089
Gene: ENSMUSG00000029510
AA Change: L213P

DomainStartEndE-ValueType
Pfam:Glypican 7 560 2.8e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048028
SMART Domains Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 188 301 3.1e-38 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159067
AA Change: L213P

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247
AA Change: L213P

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159689
Predicted Effect probably benign
Transcript: ENSMUST00000160729
SMART Domains Protein: ENSMUSP00000124170
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161113
Predicted Effect probably benign
Transcript: ENSMUST00000161691
SMART Domains Protein: ENSMUSP00000125290
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161827
AA Change: L213P

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124459
Gene: ENSMUSG00000029510
AA Change: L213P

DomainStartEndE-ValueType
Pfam:Glypican 11 566 3.1e-199 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161984
AA Change: L213P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137879
Gene: ENSMUSG00000029510
AA Change: L213P

DomainStartEndE-ValueType
Pfam:Glypican 7 342 3.7e-134 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162909
Predicted Effect probably benign
Transcript: ENSMUST00000162245
SMART Domains Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 185 304 4e-50 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Meta Mutation Damage Score 0.8831 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Gpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Gpc2 APN 5 138274309 utr 3 prime probably benign
IGL00938:Gpc2 APN 5 138278907 missense probably benign 0.08
IGL01315:Gpc2 APN 5 138276039 missense probably benign 0.00
IGL01583:Gpc2 APN 5 138275530 missense probably damaging 1.00
IGL01590:Gpc2 APN 5 138274378 missense probably damaging 0.99
IGL02040:Gpc2 APN 5 138276582 critical splice donor site probably null
IGL02322:Gpc2 APN 5 138276237 splice site probably null
IGL02655:Gpc2 APN 5 138278925 missense possibly damaging 0.73
R0638:Gpc2 UTSW 5 138278534 missense possibly damaging 0.79
R1918:Gpc2 UTSW 5 138278379 missense probably benign 0.01
R4177:Gpc2 UTSW 5 138277359 unclassified probably benign
R4361:Gpc2 UTSW 5 138278290 nonsense probably null
R5178:Gpc2 UTSW 5 138275605 missense possibly damaging 0.59
R5250:Gpc2 UTSW 5 138278968 missense probably damaging 1.00
R5365:Gpc2 UTSW 5 138275623 missense probably damaging 1.00
R6182:Gpc2 UTSW 5 138278414 missense probably benign 0.01
R6548:Gpc2 UTSW 5 138277271 splice site probably null
R6985:Gpc2 UTSW 5 138278408 missense probably damaging 1.00
R7064:Gpc2 UTSW 5 138278910 missense probably damaging 1.00
R7821:Gpc2 UTSW 5 138276297 missense probably benign 0.43
R8460:Gpc2 UTSW 5 138276629 missense not run
Predicted Primers PCR Primer
(F):5'- GCTTGAGATGGGGATCACCAAGTC -3'
(R):5'- CCAGCACGCCGTCATCTTCAATAG -3'

Sequencing Primer
(F):5'- ATCACCAAGTCAGAGAAGGC -3'
(R):5'- CTACTATGAGAAGTCTGGCGAG -3'
Posted On2014-01-05