Incidental Mutation 'R1004:Agbl3'
ID 97946
Institutional Source Beutler Lab
Gene Symbol Agbl3
Ensembl Gene ENSMUSG00000038836
Gene Name ATP/GTP binding protein-like 3
Synonyms Ccp3, 2900053G10Rik, 6530406M24Rik, Ccp3, 4930431N21Rik
MMRRC Submission 039114-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1004 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 34757367-34836394 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34780386 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 453 (E453V)
Ref Sequence ENSEMBL: ENSMUSP00000110668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]
AlphaFold Q8CDP0
Predicted Effect probably damaging
Transcript: ENSMUST00000115016
AA Change: E453V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: E453V

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115017
AA Change: E448V

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: E448V

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135304
SMART Domains Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143474
Predicted Effect probably benign
Transcript: ENSMUST00000148834
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155890
Meta Mutation Damage Score 0.5345 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,042,780 (GRCm39) I423T possibly damaging Het
Agxt A G 1: 93,063,421 (GRCm39) M108V possibly damaging Het
Akap13 T C 7: 75,337,034 (GRCm39) I831T probably damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arid1a A G 4: 133,414,586 (GRCm39) M1215T unknown Het
Cd163 G T 6: 124,302,306 (GRCm39) D957Y probably damaging Het
Ces2e A G 8: 105,656,370 (GRCm39) D200G probably damaging Het
Cfap54 T C 10: 92,902,558 (GRCm39) probably benign Het
Col11a1 A G 3: 113,888,671 (GRCm39) probably benign Het
Dlx6 C T 6: 6,863,665 (GRCm39) Q96* probably null Het
Dpp4 T A 2: 62,162,984 (GRCm39) Q754L probably benign Het
Ece1 A G 4: 137,653,550 (GRCm39) T100A probably benign Het
Gabbr2 C T 4: 46,677,544 (GRCm39) V779M possibly damaging Het
Gatm C T 2: 122,440,141 (GRCm39) probably benign Het
Gpc2 A G 5: 138,276,487 (GRCm39) L213P probably damaging Het
Hook1 A C 4: 95,910,524 (GRCm39) N713H probably benign Het
Kdm5b T A 1: 134,516,642 (GRCm39) I178K possibly damaging Het
Mettl9 G A 7: 120,675,460 (GRCm39) V287I probably benign Het
Mroh2a C A 1: 88,170,142 (GRCm39) A685D possibly damaging Het
Mycbp2 G A 14: 103,378,353 (GRCm39) T3774I probably benign Het
Nup58 C A 14: 60,484,930 (GRCm39) probably benign Het
Nxf1 A T 19: 8,741,681 (GRCm39) T119S probably benign Het
Oaz3 T A 3: 94,342,350 (GRCm39) H102L probably damaging Het
Or8g2b T C 9: 39,751,276 (GRCm39) F182S probably benign Het
Pfpl A T 19: 12,407,789 (GRCm39) Q680L probably benign Het
Poli T A 18: 70,658,509 (GRCm39) Q75L probably benign Het
Ppp2r3d C T 9: 101,075,829 (GRCm39) probably null Het
Prr30 A G 14: 101,436,529 (GRCm39) L11P probably damaging Het
Ptchd4 A T 17: 42,688,493 (GRCm39) Y345F probably benign Het
Ric1 A G 19: 29,579,757 (GRCm39) N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,518,225 (GRCm39) probably benign Het
Sh3bgrl2 C T 9: 83,459,684 (GRCm39) probably benign Het
Skp1 G C 11: 52,128,207 (GRCm39) probably benign Het
Slc12a9 T C 5: 137,320,786 (GRCm39) K528R probably damaging Het
Slc22a6 A G 19: 8,595,763 (GRCm39) N35S probably damaging Het
Tcstv2c T A 13: 120,616,558 (GRCm39) D132E probably benign Het
Xrcc5 A G 1: 72,422,937 (GRCm39) probably benign Het
Zfp235 T A 7: 23,840,169 (GRCm39) L266Q probably damaging Het
Zfp600 T A 4: 146,133,103 (GRCm39) probably benign Het
Other mutations in Agbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Agbl3 APN 6 34,823,771 (GRCm39) missense probably damaging 1.00
IGL00835:Agbl3 APN 6 34,776,667 (GRCm39) missense probably damaging 1.00
IGL00840:Agbl3 APN 6 34,776,094 (GRCm39) missense possibly damaging 0.95
IGL01090:Agbl3 APN 6 34,776,822 (GRCm39) missense probably benign 0.40
IGL01123:Agbl3 APN 6 34,823,911 (GRCm39) nonsense probably null
IGL01707:Agbl3 APN 6 34,816,389 (GRCm39) missense possibly damaging 0.78
IGL01728:Agbl3 APN 6 34,759,092 (GRCm39) start codon destroyed probably null
IGL02335:Agbl3 APN 6 34,776,685 (GRCm39) missense probably damaging 1.00
IGL02420:Agbl3 APN 6 34,762,242 (GRCm39) missense possibly damaging 0.47
IGL02551:Agbl3 APN 6 34,800,006 (GRCm39) missense possibly damaging 0.88
IGL02974:Agbl3 APN 6 34,776,757 (GRCm39) missense probably damaging 1.00
IGL03167:Agbl3 APN 6 34,834,594 (GRCm39) missense possibly damaging 0.92
IGL03182:Agbl3 APN 6 34,780,435 (GRCm39) missense probably damaging 1.00
R0044:Agbl3 UTSW 6 34,776,834 (GRCm39) missense probably damaging 1.00
R0499:Agbl3 UTSW 6 34,816,270 (GRCm39) missense probably benign
R0639:Agbl3 UTSW 6 34,776,640 (GRCm39) missense probably damaging 1.00
R0850:Agbl3 UTSW 6 34,776,139 (GRCm39) missense probably damaging 1.00
R1080:Agbl3 UTSW 6 34,805,170 (GRCm39) missense probably benign 0.14
R1589:Agbl3 UTSW 6 34,834,452 (GRCm39) missense possibly damaging 0.77
R2361:Agbl3 UTSW 6 34,809,440 (GRCm39) missense possibly damaging 0.87
R2495:Agbl3 UTSW 6 34,823,699 (GRCm39) missense probably damaging 1.00
R3236:Agbl3 UTSW 6 34,800,022 (GRCm39) splice site probably null
R3237:Agbl3 UTSW 6 34,800,022 (GRCm39) splice site probably null
R3420:Agbl3 UTSW 6 34,770,900 (GRCm39) missense probably benign 0.36
R3421:Agbl3 UTSW 6 34,770,900 (GRCm39) missense probably benign 0.36
R3422:Agbl3 UTSW 6 34,770,900 (GRCm39) missense probably benign 0.36
R3810:Agbl3 UTSW 6 34,776,664 (GRCm39) missense probably damaging 1.00
R3811:Agbl3 UTSW 6 34,776,664 (GRCm39) missense probably damaging 1.00
R4059:Agbl3 UTSW 6 34,823,834 (GRCm39) missense probably damaging 1.00
R4499:Agbl3 UTSW 6 34,834,533 (GRCm39) missense probably benign 0.00
R4687:Agbl3 UTSW 6 34,775,261 (GRCm39) missense probably damaging 1.00
R4854:Agbl3 UTSW 6 34,762,219 (GRCm39) missense probably damaging 0.97
R5354:Agbl3 UTSW 6 34,791,687 (GRCm39) missense probably benign 0.03
R5386:Agbl3 UTSW 6 34,776,131 (GRCm39) missense probably damaging 1.00
R5897:Agbl3 UTSW 6 34,780,508 (GRCm39) missense probably benign 0.21
R6018:Agbl3 UTSW 6 34,776,190 (GRCm39) missense probably damaging 1.00
R6148:Agbl3 UTSW 6 34,834,688 (GRCm39) missense possibly damaging 0.87
R6305:Agbl3 UTSW 6 34,759,145 (GRCm39) missense unknown
R6525:Agbl3 UTSW 6 34,780,529 (GRCm39) nonsense probably null
R6546:Agbl3 UTSW 6 34,776,234 (GRCm39) missense probably damaging 1.00
R6743:Agbl3 UTSW 6 34,823,888 (GRCm39) missense probably benign 0.03
R6986:Agbl3 UTSW 6 34,816,387 (GRCm39) missense probably benign 0.42
R7023:Agbl3 UTSW 6 34,791,704 (GRCm39) missense probably benign 0.02
R7411:Agbl3 UTSW 6 34,791,754 (GRCm39) missense probably damaging 0.99
R7469:Agbl3 UTSW 6 34,791,349 (GRCm39) missense probably damaging 1.00
R7631:Agbl3 UTSW 6 34,834,606 (GRCm39) missense possibly damaging 0.95
R7658:Agbl3 UTSW 6 34,809,443 (GRCm39) missense probably benign 0.11
R7743:Agbl3 UTSW 6 34,823,765 (GRCm39) missense probably damaging 1.00
R7801:Agbl3 UTSW 6 34,816,300 (GRCm39) missense probably benign 0.00
R8033:Agbl3 UTSW 6 34,816,429 (GRCm39) missense possibly damaging 0.95
R8203:Agbl3 UTSW 6 34,776,414 (GRCm39) missense probably damaging 1.00
R8769:Agbl3 UTSW 6 34,834,549 (GRCm39) missense probably damaging 0.96
R9072:Agbl3 UTSW 6 34,776,387 (GRCm39) missense probably damaging 1.00
R9073:Agbl3 UTSW 6 34,776,387 (GRCm39) missense probably damaging 1.00
R9210:Agbl3 UTSW 6 34,775,177 (GRCm39) missense probably damaging 0.98
R9255:Agbl3 UTSW 6 34,789,840 (GRCm39) missense probably damaging 1.00
R9536:Agbl3 UTSW 6 34,823,861 (GRCm39) missense probably benign
R9560:Agbl3 UTSW 6 34,823,843 (GRCm39) missense possibly damaging 0.94
R9662:Agbl3 UTSW 6 34,809,468 (GRCm39) nonsense probably null
RF014:Agbl3 UTSW 6 34,776,293 (GRCm39) missense possibly damaging 0.53
Z1177:Agbl3 UTSW 6 34,776,343 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAGAAATGCGTCCTTATGGAAAAC -3'
(R):5'- ACTGAGCAGCTCCAACATTTTCAGTG -3'

Sequencing Primer
(F):5'- AGCTAAGGTCTACTTATTTACTTGGA -3'
(R):5'- TGCTGCTACCATCACAACCA -3'
Posted On 2014-01-05