Mutagenetix > Incidental Mutation

Incidental Mutation 'R1004:Agbl3'

97946

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

039114-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1004 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34803451 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 453 (E453V)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: E453V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: E453V

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115017
AA Change: E448V

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: E448V

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135304

SMART Domains

Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143474

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155726

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202017

Meta Mutation Damage Score

0.5345

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (41/41)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,151,954	I423T	possibly damaging	Het
Agxt	A	G	1: 93,135,699	M108V	possibly damaging	Het
Akap13	T	C	7: 75,687,286	I831T	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arid1a	A	G	4: 133,687,275	M1215T	unknown	Het
Cd163	G	T	6: 124,325,347	D957Y	probably damaging	Het
Ces2e	A	G	8: 104,929,738	D200G	probably damaging	Het
Cfap54	T	C	10: 93,066,696		probably benign	Het
Col11a1	A	G	3: 114,095,022		probably benign	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Dpp4	T	A	2: 62,332,640	Q754L	probably benign	Het
Ece1	A	G	4: 137,926,239	T100A	probably benign	Het
Gabbr2	C	T	4: 46,677,544	V779M	possibly damaging	Het
Gatm	C	T	2: 122,609,660		probably benign	Het
Gm20767	T	A	13: 120,155,022	D132E	probably benign	Het
Gpc2	A	G	5: 138,278,225	L213P	probably damaging	Het
Hook1	A	C	4: 96,022,287	N713H	probably benign	Het
Kdm5b	T	A	1: 134,588,904	I178K	possibly damaging	Het
Mettl9	G	A	7: 121,076,237	V287I	probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mycbp2	G	A	14: 103,140,917	T3774I	probably benign	Het
Nupl1	C	A	14: 60,247,481		probably benign	Het
Nxf1	A	T	19: 8,764,317	T119S	probably benign	Het
Oaz3	T	A	3: 94,435,043	H102L	probably damaging	Het
Olfr971	T	C	9: 39,839,980	F182S	probably benign	Het
Pfpl	A	T	19: 12,430,425	Q680L	probably benign	Het
Poli	T	A	18: 70,525,438	Q75L	probably benign	Het
Ppp2r3a	C	T	9: 101,198,630		probably null	Het
Prr30	A	G	14: 101,199,093	L11P	probably damaging	Het
Ptchd4	A	T	17: 42,377,602	Y345F	probably benign	Het
Ric1	A	G	19: 29,602,357	N1233S	probably benign	Het
Serpinb9f	TA	"TTTNA,T"	13: 33,334,242		probably benign	Het
Sh3bgrl2	C	T	9: 83,577,631		probably benign	Het
Skp1a	G	C	11: 52,237,380		probably benign	Het
Slc12a9	T	C	5: 137,322,524	K528R	probably damaging	Het
Slc22a6	A	G	19: 8,618,399	N35S	probably damaging	Het
Xrcc5	A	G	1: 72,383,778		probably benign	Het
Zfp235	T	A	7: 24,140,744	L266Q	probably damaging	Het
Zfp600	T	A	4: 146,196,533		probably benign	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGAGAAATGCGTCCTTATGGAAAAC -3'
(R):5'- ACTGAGCAGCTCCAACATTTTCAGTG -3'

Sequencing Primer
(F):5'- AGCTAAGGTCTACTTATTTACTTGGA -3'
(R):5'- TGCTGCTACCATCACAACCA -3'

Posted On

2014-01-05