Incidental Mutation 'R1004:Akap13'
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene NameA kinase (PRKA) anchor protein 13
SynonymsAKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1004 (G1)
Quality Score225
Status Validated
Chromosomal Location75455534-75754609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75687286 bp
Amino Acid Change Isoleucine to Threonine at position 831 (I831T)
Ref Sequence ENSEMBL: ENSMUSP00000146990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750] [ENSMUST00000207923]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000147005
AA Change: I1674T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: I1674T

low complexity region 174 184 N/A INTRINSIC
internal_repeat_1 485 695 4.85e-5 PROSPERO
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
Pfam:RII_binding_1 1218 1235 4.3e-6 PFAM
low complexity region 1429 1444 N/A INTRINSIC
low complexity region 1479 1501 N/A INTRINSIC
low complexity region 1601 1612 N/A INTRINSIC
low complexity region 1738 1768 N/A INTRINSIC
C1 1773 1819 1.95e-4 SMART
low complexity region 1876 1887 N/A INTRINSIC
RhoGEF 1979 2171 1.28e-61 SMART
PH 2213 2316 2.94e-11 SMART
coiled coil region 2326 2363 N/A INTRINSIC
low complexity region 2411 2430 N/A INTRINSIC
low complexity region 2462 2472 N/A INTRINSIC
coiled coil region 2551 2664 N/A INTRINSIC
low complexity region 2746 2752 N/A INTRINSIC
low complexity region 2758 2771 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166315
AA Change: I1656T

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: I1656T

low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207750
AA Change: I1674T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000207923
AA Change: I831T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect unknown
Transcript: ENSMUST00000207998
AA Change: I333T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208456
Predicted Effect unknown
Transcript: ENSMUST00000208708
AA Change: I498T
Meta Mutation Damage Score 0.1551 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75725971 missense probably damaging 0.99
IGL00332:Akap13 APN 7 75728919 missense probably damaging 1.00
IGL00481:Akap13 APN 7 75723895 missense probably damaging 1.00
IGL00590:Akap13 APN 7 75610669 missense probably benign 0.01
IGL00655:Akap13 APN 7 75704398 missense probably damaging 0.99
IGL00766:Akap13 APN 7 75704512 missense probably damaging 0.96
IGL00818:Akap13 APN 7 75609727 missense probably benign 0.00
IGL00826:Akap13 APN 7 75677447 missense probably damaging 1.00
IGL01014:Akap13 APN 7 75750633 utr 3 prime probably benign
IGL01090:Akap13 APN 7 75666531 missense probably benign 0.44
IGL01155:Akap13 APN 7 75569936 missense probably damaging 1.00
IGL01326:Akap13 APN 7 75725348 missense probably benign 0.30
IGL01456:Akap13 APN 7 75602847 missense probably damaging 0.98
IGL01460:Akap13 APN 7 75747846 missense probably benign 0.29
IGL01568:Akap13 APN 7 75608522 nonsense probably null 0.00
IGL01610:Akap13 APN 7 75720180 missense possibly damaging 0.71
IGL01610:Akap13 APN 7 75747605 missense probably damaging 1.00
IGL01615:Akap13 APN 7 75697393 missense probably damaging 1.00
IGL01667:Akap13 APN 7 75570019 missense probably damaging 1.00
IGL01705:Akap13 APN 7 75746767 missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75666545 missense probably benign 0.27
IGL02269:Akap13 APN 7 75602911 missense probably benign
IGL02421:Akap13 APN 7 75717806 missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75609188 missense probably damaging 0.96
IGL02944:Akap13 APN 7 75608657 missense probably benign
IGL03051:Akap13 APN 7 75610485 nonsense probably null
IGL03160:Akap13 APN 7 75730417 missense probably damaging 1.00
IGL03245:Akap13 APN 7 75609752 missense probably damaging 0.99
R0254:Akap13 UTSW 7 75736604 splice site probably benign
R0310:Akap13 UTSW 7 75614930 missense probably damaging 0.99
R0373:Akap13 UTSW 7 75609929 missense probably benign 0.00
R0373:Akap13 UTSW 7 75730500 missense probably damaging 1.00
R0408:Akap13 UTSW 7 75746796 missense probably damaging 1.00
R0631:Akap13 UTSW 7 75614996 missense probably damaging 0.99
R0646:Akap13 UTSW 7 75747746 missense probably damaging 1.00
R0781:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75725380 missense probably damaging 1.00
R1024:Akap13 UTSW 7 75677409 missense probably damaging 1.00
R1110:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75586193 missense probably damaging 0.97
R1442:Akap13 UTSW 7 75735778 missense probably damaging 0.99
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75677194 missense probably damaging 1.00
R1773:Akap13 UTSW 7 75683451 missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1786:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1791:Akap13 UTSW 7 75611035 missense probably benign 0.00
R1819:Akap13 UTSW 7 75608705 missense probably benign 0.04
R1879:Akap13 UTSW 7 75610727 missense probably benign 0.01
R1989:Akap13 UTSW 7 75704516 missense probably benign 0.01
R2016:Akap13 UTSW 7 75704531 missense probably damaging 0.99
R2092:Akap13 UTSW 7 75610570 missense probably benign 0.05
R2126:Akap13 UTSW 7 75725304 missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2132:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2133:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2251:Akap13 UTSW 7 75739477 missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75666550 missense probably damaging 1.00
R3713:Akap13 UTSW 7 75586181 missense probably damaging 0.98
R3731:Akap13 UTSW 7 75611377 missense probably benign 0.39
R3765:Akap13 UTSW 7 75608837 missense probably benign 0.04
R3788:Akap13 UTSW 7 75702153 critical splice donor site probably null
R3793:Akap13 UTSW 7 75610141 missense probably benign 0.00
R3970:Akap13 UTSW 7 75569951 nonsense probably null
R4205:Akap13 UTSW 7 75610919 missense probably benign 0.05
R4257:Akap13 UTSW 7 75611285 missense probably damaging 0.98
R4374:Akap13 UTSW 7 75608984 missense probably damaging 0.96
R4448:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4450:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4457:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4458:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4466:Akap13 UTSW 7 75602773 splice site probably null
R4632:Akap13 UTSW 7 75666553 missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4669:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4671:Akap13 UTSW 7 75579564 nonsense probably null
R4821:Akap13 UTSW 7 75677507 intron probably benign
R4868:Akap13 UTSW 7 75743504 missense probably damaging 1.00
R4894:Akap13 UTSW 7 75725320 missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75749240 missense probably benign 0.22
R4962:Akap13 UTSW 7 75749430 missense probably damaging 0.98
R4988:Akap13 UTSW 7 75730528 missense probably damaging 1.00
R5119:Akap13 UTSW 7 75687252 missense probably damaging 0.98
R5141:Akap13 UTSW 7 75609614 missense probably benign 0.18
R5419:Akap13 UTSW 7 75610243 missense probably benign 0.01
R5427:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75602904 missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75602830 missense probably damaging 1.00
R5458:Akap13 UTSW 7 75586301 missense probably damaging 1.00
R5636:Akap13 UTSW 7 75704372 missense probably damaging 0.96
R5643:Akap13 UTSW 7 75702154 critical splice donor site probably null
R5898:Akap13 UTSW 7 75729146 missense probably damaging 1.00
R5932:Akap13 UTSW 7 75610184 missense probably damaging 1.00
R6135:Akap13 UTSW 7 75609908 missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75677416 missense probably damaging 1.00
R6182:Akap13 UTSW 7 75586280 missense probably benign 0.45
R6310:Akap13 UTSW 7 75749193 missense probably damaging 0.99
R6346:Akap13 UTSW 7 75685254 missense probably damaging 1.00
R6466:Akap13 UTSW 7 75727044 missense probably benign 0.01
R6605:Akap13 UTSW 7 75579768 missense probably damaging 0.98
R6617:Akap13 UTSW 7 75730363 missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75569981 missense probably damaging 1.00
R6703:Akap13 UTSW 7 75602898 missense probably damaging 1.00
R6750:Akap13 UTSW 7 75739458 missense probably benign 0.03
R7069:Akap13 UTSW 7 75610262 missense probably benign 0.29
R7116:Akap13 UTSW 7 75720195 missense probably benign 0.00
R7158:Akap13 UTSW 7 75579594 missense probably damaging 0.97
R7159:Akap13 UTSW 7 75730579 missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7468:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7471:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7472:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7477:Akap13 UTSW 7 75749247 missense probably benign
R7636:Akap13 UTSW 7 75609873 missense probably benign 0.04
R7650:Akap13 UTSW 7 75643454 missense probably benign 0.20
R7671:Akap13 UTSW 7 75569900 missense probably damaging 1.00
R7681:Akap13 UTSW 7 75728796 missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75677258 missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75610328 missense probably benign 0.00
R7816:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7817:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7834:Akap13 UTSW 7 75742642 missense possibly damaging 0.85
R7880:Akap13 UTSW 7 75586216 missense probably damaging 0.97
R7942:Akap13 UTSW 7 75611470 missense possibly damaging 0.50
R8006:Akap13 UTSW 7 75579696 missense probably damaging 1.00
R8009:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8011:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8012:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8013:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8016:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8089:Akap13 UTSW 7 75610592 missense possibly damaging 0.94
R8138:Akap13 UTSW 7 75702231 splice site probably null
R8174:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75747804 missense probably damaging 1.00
R8444:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8445:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8465:Akap13 UTSW 7 75727038 missense probably benign 0.11
R8512:Akap13 UTSW 7 75611086 missense probably damaging 0.99
R8523:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8793:Akap13 UTSW 7 75725328 missense probably benign 0.35
R8907:Akap13 UTSW 7 75610696 missense probably benign 0.08
R8907:Akap13 UTSW 7 75610708 missense probably damaging 0.99
R8929:Akap13 UTSW 7 75609004 missense probably benign 0.00
R8937:Akap13 UTSW 7 75534853 critical splice donor site probably null
R8967:Akap13 UTSW 7 75729134 missense possibly damaging 0.80
R8986:Akap13 UTSW 7 75609326 missense probably benign
Z1176:Akap13 UTSW 7 75730552 missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75615005 missense probably benign 0.17
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgaaggagagtgataaagaaaggg -3'
Posted On2014-01-05