Mutagenetix > Incidental Mutation

Incidental Mutation 'R1004:Anpep'

97956

Institutional Source

Beutler Lab

Gene Symbol

Anpep

Ensembl Gene

ENSMUSG00000039062

Gene Name

alanyl (membrane) aminopeptidase

Synonyms

aminopeptidase N, Cd13, Apn

MMRRC Submission

039114-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1004 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79821803-79861059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 79838256 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 518 (E518K)

Ref Sequence

ENSEMBL: ENSMUSP00000103015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502] [ENSMUST00000206235]

AlphaFold

P97449

Predicted Effect

probably benign
Transcript: ENSMUST00000049004
AA Change: E518K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: E518K

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	6.3e-142	PFAM
Pfam:Peptidase_MA_2	355	502	1.4e-21	PFAM
Pfam:ERAP1_C	618	944	2.9e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107392
AA Change: E518K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: E518K

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	2.5e-139	PFAM
Pfam:ERAP1_C	618	943	2e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149164

Predicted Effect

probably benign
Transcript: ENSMUST00000205502

Predicted Effect

probably benign
Transcript: ENSMUST00000206235

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,151,954	I423T	possibly damaging	Het
Agbl3	A	T	6: 34,803,451	E453V	probably damaging	Het
Agxt	A	G	1: 93,135,699	M108V	possibly damaging	Het
Akap13	T	C	7: 75,687,286	I831T	probably damaging	Het
Arid1a	A	G	4: 133,687,275	M1215T	unknown	Het
Cd163	G	T	6: 124,325,347	D957Y	probably damaging	Het
Ces2e	A	G	8: 104,929,738	D200G	probably damaging	Het
Cfap54	T	C	10: 93,066,696		probably benign	Het
Col11a1	A	G	3: 114,095,022		probably benign	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Dpp4	T	A	2: 62,332,640	Q754L	probably benign	Het
Ece1	A	G	4: 137,926,239	T100A	probably benign	Het
Gabbr2	C	T	4: 46,677,544	V779M	possibly damaging	Het
Gatm	C	T	2: 122,609,660		probably benign	Het
Gm20767	T	A	13: 120,155,022	D132E	probably benign	Het
Gpc2	A	G	5: 138,278,225	L213P	probably damaging	Het
Hook1	A	C	4: 96,022,287	N713H	probably benign	Het
Kdm5b	T	A	1: 134,588,904	I178K	possibly damaging	Het
Mettl9	G	A	7: 121,076,237	V287I	probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mycbp2	G	A	14: 103,140,917	T3774I	probably benign	Het
Nupl1	C	A	14: 60,247,481		probably benign	Het
Nxf1	A	T	19: 8,764,317	T119S	probably benign	Het
Oaz3	T	A	3: 94,435,043	H102L	probably damaging	Het
Olfr971	T	C	9: 39,839,980	F182S	probably benign	Het
Pfpl	A	T	19: 12,430,425	Q680L	probably benign	Het
Poli	T	A	18: 70,525,438	Q75L	probably benign	Het
Ppp2r3a	C	T	9: 101,198,630		probably null	Het
Prr30	A	G	14: 101,199,093	L11P	probably damaging	Het
Ptchd4	A	T	17: 42,377,602	Y345F	probably benign	Het
Ric1	A	G	19: 29,602,357	N1233S	probably benign	Het
Serpinb9f	TA	"TTTNA,T"	13: 33,334,242		probably benign	Het
Sh3bgrl2	C	T	9: 83,577,631		probably benign	Het
Skp1a	G	C	11: 52,237,380		probably benign	Het
Slc12a9	T	C	5: 137,322,524	K528R	probably damaging	Het
Slc22a6	A	G	19: 8,618,399	N35S	probably damaging	Het
Xrcc5	A	G	1: 72,383,778		probably benign	Het
Zfp235	T	A	7: 24,140,744	L266Q	probably damaging	Het
Zfp600	T	A	4: 146,196,533		probably benign	Het

Other mutations in Anpep

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Anpep	APN	7	79825736	missense	possibly damaging	0.64
IGL00089:Anpep	APN	7	79841986	missense	probably damaging	1.00
IGL00767:Anpep	APN	7	79840890	missense	probably benign	0.00
IGL00901:Anpep	APN	7	79839423	missense	probably benign
IGL01919:Anpep	APN	7	79825350	missense	possibly damaging	0.77
IGL02049:Anpep	APN	7	79835181	missense	probably damaging	0.97
IGL02195:Anpep	APN	7	79826685	missense	probably damaging	1.00
IGL02210:Anpep	APN	7	79826904	missense	probably benign	0.00
IGL02584:Anpep	APN	7	79825393	splice site	probably benign
IGL02677:Anpep	APN	7	79838730	missense	probably damaging	1.00
IGL03073:Anpep	APN	7	79838955	missense	probably damaging	1.00
IGL03100:Anpep	APN	7	79836361	missense	probably benign	0.01
PIT4696001:Anpep	UTSW	7	79839464	missense	possibly damaging	0.85
R0329:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0330:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0619:Anpep	UTSW	7	79841009	missense	probably benign
R0691:Anpep	UTSW	7	79839299	missense	probably damaging	0.98
R1005:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1274:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1288:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1289:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1532:Anpep	UTSW	7	79826948	nonsense	probably null
R1540:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1618:Anpep	UTSW	7	79835417	missense	probably benign	0.00
R1627:Anpep	UTSW	7	79842011	missense	probably benign
R1693:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1717:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1745:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1746:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1748:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1809:Anpep	UTSW	7	79841823	missense	probably benign	0.01
R1901:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1902:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1903:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1985:Anpep	UTSW	7	79840857	splice site	probably null
R2379:Anpep	UTSW	7	79841218	missense	probably benign	0.28
R2508:Anpep	UTSW	7	79838291	missense	possibly damaging	0.80
R3110:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3112:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3898:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3899:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3900:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R4211:Anpep	UTSW	7	79840996	nonsense	probably null
R4701:Anpep	UTSW	7	79839465	missense	probably benign	0.16
R4716:Anpep	UTSW	7	79826632	missense	probably benign	0.00
R5020:Anpep	UTSW	7	79833727	missense	probably benign
R5042:Anpep	UTSW	7	79839469	missense	probably benign	0.00
R5084:Anpep	UTSW	7	79826870	critical splice donor site	probably null
R5319:Anpep	UTSW	7	79841731	missense	probably benign
R5593:Anpep	UTSW	7	79842046	missense	probably benign	0.04
R5778:Anpep	UTSW	7	79836391	missense	probably benign	0.00
R5852:Anpep	UTSW	7	79838972	nonsense	probably null
R5906:Anpep	UTSW	7	79833675	missense	probably benign
R6164:Anpep	UTSW	7	79842205	missense	possibly damaging	0.68
R6254:Anpep	UTSW	7	79839233	missense	probably damaging	1.00
R6284:Anpep	UTSW	7	79825802	missense	probably damaging	1.00
R6380:Anpep	UTSW	7	79841896	missense	probably benign	0.04
R6594:Anpep	UTSW	7	79841361	splice site	probably null
R6746:Anpep	UTSW	7	79839185	splice site	probably null
R6920:Anpep	UTSW	7	79825349	missense	probably damaging	1.00
R7060:Anpep	UTSW	7	79841794	missense	probably benign	0.33
R7072:Anpep	UTSW	7	79835379	missense	possibly damaging	0.58
R7095:Anpep	UTSW	7	79842202	missense	possibly damaging	0.87
R7102:Anpep	UTSW	7	79836313	missense	probably benign	0.00
R7178:Anpep	UTSW	7	79840988	missense	probably benign
R7223:Anpep	UTSW	7	79825310	missense	probably damaging	1.00
R7344:Anpep	UTSW	7	79838650	missense	possibly damaging	0.60
R7441:Anpep	UTSW	7	79827644	missense	possibly damaging	0.93
R7479:Anpep	UTSW	7	79835370	missense	probably benign	0.11
R7503:Anpep	UTSW	7	79826637	missense	probably damaging	1.00
R7683:Anpep	UTSW	7	79839198	missense	probably damaging	0.98
R7912:Anpep	UTSW	7	79838426	missense	probably benign	0.00
R7935:Anpep	UTSW	7	79826961	missense	possibly damaging	0.46
R8036:Anpep	UTSW	7	79841898	missense	probably benign	0.11
R8039:Anpep	UTSW	7	79839400	critical splice donor site	probably null
R8470:Anpep	UTSW	7	79839521	missense	probably benign	0.16
R8549:Anpep	UTSW	7	79840896	missense	probably benign	0.00
R8723:Anpep	UTSW	7	79838938	missense	probably damaging	1.00
R8726:Anpep	UTSW	7	79840893	missense	probably benign	0.00
R9042:Anpep	UTSW	7	79838762	missense	probably damaging	0.99
R9151:Anpep	UTSW	7	79842037	missense	probably benign	0.31
R9200:Anpep	UTSW	7	79841122	missense	probably benign	0.00
R9216:Anpep	UTSW	7	79836301	missense	possibly damaging	0.49
R9570:Anpep	UTSW	7	79826913	missense	probably benign	0.00
R9769:Anpep	UTSW	7	79838730	missense	probably damaging	1.00
Z1176:Anpep	UTSW	7	79827639	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GGCTATGAGCAGAGGTTTTACCCAC -3'
(R):5'- GATGCTGTCCAGTTTCCTGACAGAG -3'

Sequencing Primer
(F):5'- ATTACTGAGCACAGCAGCTG -3'
(R):5'- AGTTTCCTGACAGAGGACCTG -3'

Posted On

2014-01-05