Incidental Mutation 'R1004:Mettl9'
ID97958
Institutional Source Beutler Lab
Gene Symbol Mettl9
Ensembl Gene ENSMUSG00000030876
Gene Namemethyltransferase like 9
Synonyms0610012D09Rik, Drev
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1004 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location121034445-121078329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121076237 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 287 (V287I)
Ref Sequence ENSEMBL: ENSMUSP00000033163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033163] [ENSMUST00000047194] [ENSMUST00000207351]
Predicted Effect probably benign
Transcript: ENSMUST00000033163
AA Change: V287I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033163
Gene: ENSMUSG00000030876
AA Change: V287I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:DREV 56 317 1.4e-142 PFAM
Pfam:Methyltransf_23 123 289 2.7e-12 PFAM
Pfam:Methyltransf_12 150 236 9.1e-10 PFAM
Pfam:Methyltransf_11 150 238 9.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047194
SMART Domains Protein: ENSMUSP00000039059
Gene: ENSMUSG00000035004

DomainStartEndE-ValueType
IG 35 142 2.79e-2 SMART
transmembrane domain 154 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207835
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Mettl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Mettl9 APN 7 121052113 missense probably damaging 1.00
IGL01723:Mettl9 APN 7 121052269 missense possibly damaging 0.67
PIT4402001:Mettl9 UTSW 7 121057217 missense probably damaging 0.99
R0401:Mettl9 UTSW 7 121076313 missense probably damaging 1.00
R1734:Mettl9 UTSW 7 121047841 missense probably damaging 1.00
R5574:Mettl9 UTSW 7 121047870 missense probably benign 0.03
R7913:Mettl9 UTSW 7 121076301 missense probably damaging 1.00
Z1177:Mettl9 UTSW 7 121057330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGGCAGCTCAGTCAGTGTAG -3'
(R):5'- TGAGAATGACAGTCCCCAGAGGTC -3'

Sequencing Primer
(F):5'- AGTGCCTGGAACACTAGCTC -3'
(R):5'- AGGTCCCCCTCACATCACTG -3'
Posted On2014-01-05