Incidental Mutation 'R1004:Ces2e'
ID97968
Institutional Source Beutler Lab
Gene Symbol Ces2e
Ensembl Gene ENSMUSG00000031886
Gene Namecarboxylesterase 2E
Synonyms9030624L02Rik, Ces5
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1004 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104926260-104934672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104929738 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 200 (D200G)
Ref Sequence ENSEMBL: ENSMUSP00000105037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034355] [ENSMUST00000109410]
Predicted Effect probably damaging
Transcript: ENSMUST00000034355
AA Change: D200G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034355
Gene: ENSMUSG00000031886
AA Change: D200G

DomainStartEndE-ValueType
Pfam:COesterase 11 538 1.2e-174 PFAM
Pfam:Abhydrolase_3 143 252 4.6e-11 PFAM
Pfam:Peptidase_S9 159 296 2.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109410
AA Change: D200G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105037
Gene: ENSMUSG00000031886
AA Change: D200G

DomainStartEndE-ValueType
Pfam:COesterase 9 538 1.7e-171 PFAM
Pfam:Abhydrolase_3 143 246 6.6e-11 PFAM
Pfam:Peptidase_S9 158 276 2.1e-7 PFAM
Meta Mutation Damage Score 0.7084 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Ces2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Ces2e APN 8 104929565 missense probably benign 0.42
IGL02045:Ces2e APN 8 104930658 splice site probably benign
IGL02656:Ces2e APN 8 104927056 missense possibly damaging 0.94
IGL02904:Ces2e APN 8 104931338 missense probably benign
IGL02972:Ces2e APN 8 104927061 missense probably damaging 1.00
IGL03244:Ces2e APN 8 104928819 missense probably benign 0.38
R0585:Ces2e UTSW 8 104929821 missense probably damaging 1.00
R0762:Ces2e UTSW 8 104929864 missense probably damaging 0.98
R1168:Ces2e UTSW 8 104927014 missense possibly damaging 0.49
R1731:Ces2e UTSW 8 104929576 missense probably damaging 1.00
R2134:Ces2e UTSW 8 104932539 critical splice donor site probably null
R3087:Ces2e UTSW 8 104930715 missense probably benign 0.18
R3693:Ces2e UTSW 8 104928811 missense probably damaging 1.00
R4622:Ces2e UTSW 8 104928709 splice site probably null
R4873:Ces2e UTSW 8 104927185 missense probably damaging 1.00
R4875:Ces2e UTSW 8 104927185 missense probably damaging 1.00
R4965:Ces2e UTSW 8 104933698 missense probably benign 0.09
R5365:Ces2e UTSW 8 104927214 critical splice donor site probably null
R5529:Ces2e UTSW 8 104929911 missense probably benign 0.00
R5601:Ces2e UTSW 8 104929494 missense probably benign 0.42
R5968:Ces2e UTSW 8 104932995 missense probably damaging 1.00
R6128:Ces2e UTSW 8 104928796 missense probably benign 0.03
R7337:Ces2e UTSW 8 104931056 splice site probably null
R7363:Ces2e UTSW 8 104933000 splice site probably null
R7489:Ces2e UTSW 8 104929780 missense probably benign 0.26
R7548:Ces2e UTSW 8 104931906 missense probably benign
R8068:Ces2e UTSW 8 104932997 critical splice donor site probably null
Z1088:Ces2e UTSW 8 104931347 missense probably benign
Z1088:Ces2e UTSW 8 104932398 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCACTCACTGTTGGCATGGCTTC -3'
(R):5'- TGAACACAGTACCAGCGAACTAGGG -3'

Sequencing Primer
(F):5'- CTGGCAGCAACTGAGGATG -3'
(R):5'- CTGTGAACCATCTCAGAGGAGC -3'
Posted On2014-01-05