Incidental Mutation 'R1004:Olfr971'
ID97970
Institutional Source Beutler Lab
Gene Symbol Olfr971
Ensembl Gene ENSMUSG00000093934
Gene Nameolfactory receptor 971
SynonymsMOR171-13, GA_x6K02T2PVTD-33539896-33540819
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1004 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39836876-39841281 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39839980 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 182 (F182S)
Ref Sequence ENSEMBL: ENSMUSP00000148850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075467] [ENSMUST00000214242]
Predicted Effect probably benign
Transcript: ENSMUST00000075467
AA Change: F182S

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000074913
Gene: ENSMUSG00000093934
AA Change: F182S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.6e-53 PFAM
Pfam:7tm_1 41 290 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214242
AA Change: F182S

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Olfr971
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Olfr971 APN 9 39839706 missense probably benign 0.02
IGL00920:Olfr971 APN 9 39839934 missense probably benign
IGL01759:Olfr971 APN 9 39839611 missense probably damaging 0.99
IGL02867:Olfr971 APN 9 39840237 missense probably benign 0.03
IGL02889:Olfr971 APN 9 39840237 missense probably benign 0.03
IGL02900:Olfr971 APN 9 39839812 missense probably damaging 1.00
IGL03333:Olfr971 APN 9 39840012 missense probably damaging 0.98
R0831:Olfr971 UTSW 9 39840283 missense probably damaging 1.00
R1711:Olfr971 UTSW 9 39840285 missense probably benign 0.39
R3900:Olfr971 UTSW 9 39839402 splice site probably null
R4424:Olfr971 UTSW 9 39840356 missense possibly damaging 0.52
R4530:Olfr971 UTSW 9 39840083 missense probably benign
R5385:Olfr971 UTSW 9 39839830 missense possibly damaging 0.95
R5386:Olfr971 UTSW 9 39839830 missense possibly damaging 0.95
R7199:Olfr971 UTSW 9 39839457 missense probably benign
R7849:Olfr971 UTSW 9 39840322 missense possibly damaging 0.59
R8193:Olfr971 UTSW 9 39839461 missense probably benign 0.00
R8342:Olfr971 UTSW 9 39840316 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGCTATGTTGCCATCTGTAACC -3'
(R):5'- AAACACAGAGGACACTTTCCCTTGG -3'

Sequencing Primer
(F):5'- AACCCTTTGCTTTACAAGGTTG -3'
(R):5'- GGTTCATTGAACTTACTGAAGATGGC -3'
Posted On2014-01-05