Incidental Mutation 'R1004:Sh3bgrl2'
ID 97972
Institutional Source Beutler Lab
Gene Symbol Sh3bgrl2
Ensembl Gene ENSMUSG00000032261
Gene Name SH3 domain binding glutamic acid-rich protein like 2
Synonyms A930014C21Rik
MMRRC Submission 039114-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R1004 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 83430391-83482345 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 83459684 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113215] [ENSMUST00000188030] [ENSMUST00000188241]
AlphaFold Q8BG73
Predicted Effect probably benign
Transcript: ENSMUST00000113215
SMART Domains Protein: ENSMUSP00000108841
Gene: ENSMUSG00000032261

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 1.3e-50 PFAM
Pfam:Glutaredoxin 21 76 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185664
SMART Domains Protein: ENSMUSP00000140380
Gene: ENSMUSG00000032261

DomainStartEndE-ValueType
Pfam:SH3BGR 1 58 1.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188030
SMART Domains Protein: ENSMUSP00000140348
Gene: ENSMUSG00000032261

DomainStartEndE-ValueType
Pfam:SH3BGR 1 85 8.2e-36 PFAM
Pfam:Glutaredoxin 21 76 5.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188241
SMART Domains Protein: ENSMUSP00000140951
Gene: ENSMUSG00000032261

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 2.1e-47 PFAM
Pfam:Glutaredoxin 21 76 1.1e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213703
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,042,780 (GRCm39) I423T possibly damaging Het
Agbl3 A T 6: 34,780,386 (GRCm39) E453V probably damaging Het
Agxt A G 1: 93,063,421 (GRCm39) M108V possibly damaging Het
Akap13 T C 7: 75,337,034 (GRCm39) I831T probably damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arid1a A G 4: 133,414,586 (GRCm39) M1215T unknown Het
Cd163 G T 6: 124,302,306 (GRCm39) D957Y probably damaging Het
Ces2e A G 8: 105,656,370 (GRCm39) D200G probably damaging Het
Cfap54 T C 10: 92,902,558 (GRCm39) probably benign Het
Col11a1 A G 3: 113,888,671 (GRCm39) probably benign Het
Dlx6 C T 6: 6,863,665 (GRCm39) Q96* probably null Het
Dpp4 T A 2: 62,162,984 (GRCm39) Q754L probably benign Het
Ece1 A G 4: 137,653,550 (GRCm39) T100A probably benign Het
Gabbr2 C T 4: 46,677,544 (GRCm39) V779M possibly damaging Het
Gatm C T 2: 122,440,141 (GRCm39) probably benign Het
Gpc2 A G 5: 138,276,487 (GRCm39) L213P probably damaging Het
Hook1 A C 4: 95,910,524 (GRCm39) N713H probably benign Het
Kdm5b T A 1: 134,516,642 (GRCm39) I178K possibly damaging Het
Mettl9 G A 7: 120,675,460 (GRCm39) V287I probably benign Het
Mroh2a C A 1: 88,170,142 (GRCm39) A685D possibly damaging Het
Mycbp2 G A 14: 103,378,353 (GRCm39) T3774I probably benign Het
Nup58 C A 14: 60,484,930 (GRCm39) probably benign Het
Nxf1 A T 19: 8,741,681 (GRCm39) T119S probably benign Het
Oaz3 T A 3: 94,342,350 (GRCm39) H102L probably damaging Het
Or8g2b T C 9: 39,751,276 (GRCm39) F182S probably benign Het
Pfpl A T 19: 12,407,789 (GRCm39) Q680L probably benign Het
Poli T A 18: 70,658,509 (GRCm39) Q75L probably benign Het
Ppp2r3d C T 9: 101,075,829 (GRCm39) probably null Het
Prr30 A G 14: 101,436,529 (GRCm39) L11P probably damaging Het
Ptchd4 A T 17: 42,688,493 (GRCm39) Y345F probably benign Het
Ric1 A G 19: 29,579,757 (GRCm39) N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,518,225 (GRCm39) probably benign Het
Skp1 G C 11: 52,128,207 (GRCm39) probably benign Het
Slc12a9 T C 5: 137,320,786 (GRCm39) K528R probably damaging Het
Slc22a6 A G 19: 8,595,763 (GRCm39) N35S probably damaging Het
Tcstv2c T A 13: 120,616,558 (GRCm39) D132E probably benign Het
Xrcc5 A G 1: 72,422,937 (GRCm39) probably benign Het
Zfp235 T A 7: 23,840,169 (GRCm39) L266Q probably damaging Het
Zfp600 T A 4: 146,133,103 (GRCm39) probably benign Het
Other mutations in Sh3bgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Sh3bgrl2 APN 9 83,459,607 (GRCm39) missense probably benign 0.01
IGL00950:Sh3bgrl2 APN 9 83,459,543 (GRCm39) missense probably damaging 1.00
R0119:Sh3bgrl2 UTSW 9 83,459,612 (GRCm39) missense probably damaging 0.99
R0299:Sh3bgrl2 UTSW 9 83,459,612 (GRCm39) missense probably damaging 0.99
R0499:Sh3bgrl2 UTSW 9 83,459,612 (GRCm39) missense probably damaging 0.99
R1006:Sh3bgrl2 UTSW 9 83,459,684 (GRCm39) splice site probably benign
R1331:Sh3bgrl2 UTSW 9 83,459,684 (GRCm39) splice site probably benign
R1333:Sh3bgrl2 UTSW 9 83,459,684 (GRCm39) splice site probably benign
R1556:Sh3bgrl2 UTSW 9 83,476,751 (GRCm39) missense probably damaging 1.00
R5029:Sh3bgrl2 UTSW 9 83,430,542 (GRCm39) missense possibly damaging 0.94
R5328:Sh3bgrl2 UTSW 9 83,459,509 (GRCm39) missense probably benign 0.36
R7327:Sh3bgrl2 UTSW 9 83,430,542 (GRCm39) missense possibly damaging 0.94
R7651:Sh3bgrl2 UTSW 9 83,430,525 (GRCm39) missense possibly damaging 0.52
R9715:Sh3bgrl2 UTSW 9 83,430,513 (GRCm39) start codon destroyed probably null 0.92
Predicted Primers PCR Primer
(F):5'- TCTGTCCTGGCCTAGACAATGAGAG -3'
(R):5'- CCGTCTGTGCTGCTGAATTTGC -3'

Sequencing Primer
(F):5'- CAGGCTAATCTGCAAATGTGTG -3'
(R):5'- GAAGGCACTGCCTTTACTGT -3'
Posted On 2014-01-05