Incidental Mutation 'R1004:Sh3bgrl2'
ID97972
Institutional Source Beutler Lab
Gene Symbol Sh3bgrl2
Ensembl Gene ENSMUSG00000032261
Gene NameSH3 domain binding glutamic acid-rich protein like 2
SynonymsA930014C21Rik
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1004 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location83548327-83638801 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 83577631 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113215] [ENSMUST00000188030] [ENSMUST00000188241]
Predicted Effect probably benign
Transcript: ENSMUST00000113215
SMART Domains Protein: ENSMUSP00000108841
Gene: ENSMUSG00000032261

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 1.3e-50 PFAM
Pfam:Glutaredoxin 21 76 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185664
SMART Domains Protein: ENSMUSP00000140380
Gene: ENSMUSG00000032261

DomainStartEndE-ValueType
Pfam:SH3BGR 1 58 1.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188030
SMART Domains Protein: ENSMUSP00000140348
Gene: ENSMUSG00000032261

DomainStartEndE-ValueType
Pfam:SH3BGR 1 85 8.2e-36 PFAM
Pfam:Glutaredoxin 21 76 5.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188241
SMART Domains Protein: ENSMUSP00000140951
Gene: ENSMUSG00000032261

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 2.1e-47 PFAM
Pfam:Glutaredoxin 21 76 1.1e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213703
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Sh3bgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Sh3bgrl2 APN 9 83577554 missense probably benign 0.01
IGL00950:Sh3bgrl2 APN 9 83577490 missense probably damaging 1.00
R0119:Sh3bgrl2 UTSW 9 83577559 missense probably damaging 0.99
R0299:Sh3bgrl2 UTSW 9 83577559 missense probably damaging 0.99
R0499:Sh3bgrl2 UTSW 9 83577559 missense probably damaging 0.99
R1006:Sh3bgrl2 UTSW 9 83577631 splice site probably benign
R1331:Sh3bgrl2 UTSW 9 83577631 splice site probably benign
R1333:Sh3bgrl2 UTSW 9 83577631 splice site probably benign
R1556:Sh3bgrl2 UTSW 9 83594698 missense probably damaging 1.00
R5029:Sh3bgrl2 UTSW 9 83548489 missense possibly damaging 0.94
R5328:Sh3bgrl2 UTSW 9 83577456 missense probably benign 0.36
R7327:Sh3bgrl2 UTSW 9 83548489 missense possibly damaging 0.94
R7651:Sh3bgrl2 UTSW 9 83548472 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TCTGTCCTGGCCTAGACAATGAGAG -3'
(R):5'- CCGTCTGTGCTGCTGAATTTGC -3'

Sequencing Primer
(F):5'- CAGGCTAATCTGCAAATGTGTG -3'
(R):5'- GAAGGCACTGCCTTTACTGT -3'
Posted On2014-01-05