Incidental Mutation 'R1004:Skp1a'
Institutional Source Beutler Lab
Gene Symbol Skp1a
Ensembl Gene ENSMUSG00000036309
Gene NameS-phase kinase-associated protein 1A
Synonyms2610043E24Rik, Tceb1l, p19Skp1, 2610206H23Rik
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.654) question?
Stock #R1004 (G1)
Quality Score225
Status Validated
Chromosomal Location52231995-52246858 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to C at 52237380 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037324] [ENSMUST00000109072] [ENSMUST00000116595] [ENSMUST00000147684] [ENSMUST00000166537]
Predicted Effect probably benign
Transcript: ENSMUST00000037324
SMART Domains Protein: ENSMUSP00000038744
Gene: ENSMUSG00000036309

Skp1 1 112 1.13e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093121
Predicted Effect probably benign
Transcript: ENSMUST00000109072
SMART Domains Protein: ENSMUSP00000104700
Gene: ENSMUSG00000036309

Skp1 1 112 1.13e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116595
SMART Domains Protein: ENSMUSP00000112294
Gene: ENSMUSG00000036309

Pfam:Skp1_POZ 1 28 6.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143016
Predicted Effect probably benign
Transcript: ENSMUST00000147684
SMART Domains Protein: ENSMUSP00000129711
Gene: ENSMUSG00000036309

Pfam:Skp1_POZ 2 47 1.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166537
SMART Domains Protein: ENSMUSP00000131833
Gene: ENSMUSG00000036309

Skp1 1 64 1.04e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of SCF complexes, which are composed of this protein, cullin 1, a ring-box protein, and one member of the F-box family of proteins. This protein binds directly to the F-box motif found in F-box proteins. SCF complexes are involved in the regulated ubiquitination of specific protein substrates, which targets them for degradation by the proteosome. Specific F-box proteins recognize different target protein(s), and many specific SCF substrates have been identified including regulators of cell cycle progression and development. Studies have also characterized the protein as an RNA polymerase II elongation factor. Alternative splicing of this gene results in two transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Skp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0689:Skp1a UTSW 11 52243765 intron probably benign
R1710:Skp1a UTSW 11 52242615 missense probably benign 0.00
R2250:Skp1a UTSW 11 52243619 missense possibly damaging 0.95
R4468:Skp1a UTSW 11 52245078 missense probably benign 0.04
R4469:Skp1a UTSW 11 52245078 missense probably benign 0.04
R4592:Skp1a UTSW 11 52243619 missense possibly damaging 0.95
R4976:Skp1a UTSW 11 52243631 missense probably benign 0.01
R5576:Skp1a UTSW 11 52242588 missense possibly damaging 0.76
R8746:Skp1a UTSW 11 52246016 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cacacatttaatcccagcttttatc -3'
(R):5'- ggcatccatactgagcaatttac -3'
Posted On2014-01-05