Mutagenetix > Incidental Mutation

Incidental Mutation 'R1099:Pdzd2'

97985

Institutional Source

Beutler Lab

Gene Symbol

Pdzd2

Ensembl Gene

ENSMUSG00000022197

Gene Name

PDZ domain containing 2

Synonyms

Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364

MMRRC Submission

039173-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R1099 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12359711-12739924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12373087 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 2321 (S2321P)

Ref Sequence

ENSEMBL: ENSMUSP00000074788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075317]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075317
AA Change: S2321P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: S2321P

Domain	Start	End	E-Value	Type
PDZ	81	179	1.27e-2	SMART
PDZ	342	419	1.51e-18	SMART
PDZ	597	675	5.25e-18	SMART
low complexity region	690	718	N/A	INTRINSIC
PDZ	738	817	1.64e-10	SMART
low complexity region	861	869	N/A	INTRINSIC
low complexity region	969	984	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
low complexity region	1436	1459	N/A	INTRINSIC
low complexity region	1525	1537	N/A	INTRINSIC
low complexity region	1538	1553	N/A	INTRINSIC
low complexity region	1567	1586	N/A	INTRINSIC
low complexity region	2111	2129	N/A	INTRINSIC
low complexity region	2190	2198	N/A	INTRINSIC
low complexity region	2335	2354	N/A	INTRINSIC
low complexity region	2469	2479	N/A	INTRINSIC
PDZ	2589	2666	1.3e-13	SMART
PDZ	2716	2794	9.42e-20	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abca7	G	T	10: 80,013,743	E1921*	probably null	Het
Acnat2	G	A	4: 49,380,484	T298I	probably benign	Het
Agbl4	T	C	4: 110,955,663		probably null	Het
Angpt2	T	A	8: 18,699,133	T323S	probably damaging	Het
Ano2	A	G	6: 125,807,847	K299R	probably damaging	Het
Armc2	G	T	10: 41,917,187	Q814K	probably benign	Het
Atp9b	A	C	18: 80,858,626	I263S	probably damaging	Het
Cadps2	A	G	6: 23,599,479	I276T	probably damaging	Het
Casp12	T	A	9: 5,352,204	H135Q	probably benign	Het
Ccdc180	A	G	4: 45,914,225	I621V	probably benign	Het
Cd160	G	A	3: 96,805,840	A36V	probably damaging	Het
Ctcfl	A	T	2: 173,112,360	C315S	probably damaging	Het
Egflam	A	G	15: 7,252,422	V411A	probably benign	Het
Ezh1	T	C	11: 101,193,808		probably null	Het
Fam171a1	T	A	2: 3,225,317	S371T	probably benign	Het
Hspbap1	T	G	16: 35,824,944	F333C	probably damaging	Het
Ky	G	C	9: 102,537,724	W278C	probably damaging	Het
Lrig3	T	A	10: 126,007,014		probably null	Het
Map3k6	A	T	4: 133,247,128	S580C	probably damaging	Het
Mark2	T	C	19: 7,277,425	T219A	probably benign	Het
Mbd5	A	G	2: 49,258,144	I789V	probably benign	Het
Myo18a	T	A	11: 77,818,901		probably null	Het
Nos1	A	G	5: 117,923,395	T929A	probably damaging	Het
Olfr373	T	A	8: 72,100,659	S300T	probably benign	Het
Olfr434	T	C	6: 43,217,624	F237S	probably damaging	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Palmd	T	C	3: 116,923,225	N541S	possibly damaging	Het
Prdm8	T	G	5: 98,183,502	I71S	probably damaging	Het
Prkg1	A	C	19: 30,571,612	S654R	probably benign	Het
Psmf1	A	T	2: 151,718,670	H260Q	probably damaging	Het
Rp1	A	T	1: 4,352,290	I179N	possibly damaging	Het
Rreb1	A	G	13: 37,948,891	K1681E	probably benign	Het
Rtn1	A	T	12: 72,304,467		probably null	Het
Scaf4	T	A	16: 90,263,098	I37F	unknown	Het
Sema4c	A	G	1: 36,552,110	S383P	probably damaging	Het
Shc4	G	T	2: 125,722,844	D178E	probably benign	Het
Slc2a5	A	G	4: 150,142,179	N366S	probably benign	Het
Slc6a3	A	G	13: 73,567,641	N465S	probably benign	Het
Tbc1d9b	C	A	11: 50,146,308	D261E	probably benign	Het
Tdrd3	A	T	14: 87,487,239	T359S	probably damaging	Het
Thap3	T	C	4: 151,983,331	M97V	probably benign	Het
Thg1l	T	A	11: 45,954,161	Q88L	possibly damaging	Het
Tjp3	T	C	10: 81,273,823	T849A	probably benign	Het
Tomm70a	G	T	16: 57,142,817	D400Y	probably damaging	Het
Trak2	T	C	1: 58,921,841	I177V	probably benign	Het
Trim66	T	C	7: 109,475,454	I533M	probably benign	Het
Ush2a	T	A	1: 188,648,348	Y2285N	probably benign	Het
Ush2a	C	T	1: 188,864,639	P3859S	probably damaging	Het

Other mutations in Pdzd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pdzd2	APN	15	12457983	missense	possibly damaging	0.93
IGL00586:Pdzd2	APN	15	12365767	splice site	probably null
IGL00697:Pdzd2	APN	15	12373647	missense	possibly damaging	0.81
IGL00721:Pdzd2	APN	15	12374412	missense	probably benign	0.00
IGL00971:Pdzd2	APN	15	12374718	missense	probably benign	0.00
IGL01066:Pdzd2	APN	15	12402632	unclassified	probably benign
IGL01389:Pdzd2	APN	15	12374626	missense	possibly damaging	0.56
IGL01505:Pdzd2	APN	15	12458207	missense	probably damaging	1.00
IGL01527:Pdzd2	APN	15	12445664	missense	probably damaging	1.00
IGL01584:Pdzd2	APN	15	12592483	missense	probably damaging	1.00
IGL01763:Pdzd2	APN	15	12372546	missense	probably benign
IGL01915:Pdzd2	APN	15	12371639	missense	probably damaging	1.00
IGL01947:Pdzd2	APN	15	12592354	missense	probably damaging	1.00
IGL02058:Pdzd2	APN	15	12376296	missense	possibly damaging	0.87
IGL02274:Pdzd2	APN	15	12445649	missense	probably damaging	1.00
IGL02408:Pdzd2	APN	15	12375765	missense	probably benign	0.00
IGL02600:Pdzd2	APN	15	12411019	missense	probably damaging	1.00
IGL02637:Pdzd2	APN	15	12385634	missense	probably benign	0.13
IGL02639:Pdzd2	APN	15	12592243	missense	probably damaging	1.00
IGL02712:Pdzd2	APN	15	12376027	missense	probably benign	0.00
IGL02967:Pdzd2	APN	15	12374341	missense	probably benign	0.04
IGL02992:Pdzd2	APN	15	12382622	missense	possibly damaging	0.77
IGL03005:Pdzd2	APN	15	12385265	missense	probably damaging	1.00
IGL03067:Pdzd2	APN	15	12388542	critical splice donor site	probably null
IGL03335:Pdzd2	APN	15	12373764	missense	probably benign	0.00
PIT4280001:Pdzd2	UTSW	15	12399288	missense	probably damaging	1.00
R0022:Pdzd2	UTSW	15	12371605	missense	possibly damaging	0.94
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0446:Pdzd2	UTSW	15	12375024	missense	probably benign	0.43
R0462:Pdzd2	UTSW	15	12592160	missense	probably damaging	1.00
R0562:Pdzd2	UTSW	15	12592278	missense	probably damaging	1.00
R0589:Pdzd2	UTSW	15	12376299	missense	probably benign	0.03
R0639:Pdzd2	UTSW	15	12458058	missense	possibly damaging	0.77
R0925:Pdzd2	UTSW	15	12399270	missense	probably damaging	1.00
R1015:Pdzd2	UTSW	15	12374508	missense	probably damaging	1.00
R1054:Pdzd2	UTSW	15	12371639	missense	probably damaging	1.00
R1070:Pdzd2	UTSW	15	12389966	critical splice donor site	probably null
R1122:Pdzd2	UTSW	15	12457895	missense	probably benign	0.25
R1126:Pdzd2	UTSW	15	12458220	missense	possibly damaging	0.94
R1381:Pdzd2	UTSW	15	12385439	missense	probably benign	0.02
R1385:Pdzd2	UTSW	15	12411022	missense	probably benign	0.38
R1513:Pdzd2	UTSW	15	12373829	missense	possibly damaging	0.88
R1538:Pdzd2	UTSW	15	12372961	missense	probably damaging	1.00
R1750:Pdzd2	UTSW	15	12385864	missense	probably damaging	1.00
R1775:Pdzd2	UTSW	15	12592460	missense	probably damaging	1.00
R1801:Pdzd2	UTSW	15	12387654	missense	possibly damaging	0.56
R1832:Pdzd2	UTSW	15	12390048	missense	probably damaging	1.00
R1856:Pdzd2	UTSW	15	12373855	missense	possibly damaging	0.87
R1870:Pdzd2	UTSW	15	12457886	missense	probably damaging	1.00
R1879:Pdzd2	UTSW	15	12373900	missense	possibly damaging	0.61
R2072:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2073:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2075:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2125:Pdzd2	UTSW	15	12373590	missense	probably benign	0.37
R2142:Pdzd2	UTSW	15	12406559	missense	probably damaging	1.00
R2155:Pdzd2	UTSW	15	12375793	missense	probably benign	0.43
R2282:Pdzd2	UTSW	15	12373848	missense	possibly damaging	0.95
R2407:Pdzd2	UTSW	15	12373161	missense	probably damaging	1.00
R3545:Pdzd2	UTSW	15	12375471	missense	probably benign	0.00
R3878:Pdzd2	UTSW	15	12376176	missense	probably benign	0.00
R3879:Pdzd2	UTSW	15	12375508	missense	probably damaging	1.00
R4396:Pdzd2	UTSW	15	12387646	missense	probably benign	0.36
R4398:Pdzd2	UTSW	15	12375975	missense	probably benign	0.30
R4491:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12419481	missense	possibly damaging	0.48
R4656:Pdzd2	UTSW	15	12385711	missense	probably benign	0.00
R4715:Pdzd2	UTSW	15	12419516	missense	possibly damaging	0.72
R4803:Pdzd2	UTSW	15	12374595	missense	probably benign	0.04
R4893:Pdzd2	UTSW	15	12385343	missense	probably benign	0.00
R4959:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R4973:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R5030:Pdzd2	UTSW	15	12592408	nonsense	probably null
R5174:Pdzd2	UTSW	15	12372514	missense	probably benign	0.01
R5230:Pdzd2	UTSW	15	12390033	missense	probably damaging	1.00
R5256:Pdzd2	UTSW	15	12372942	missense	possibly damaging	0.87
R5268:Pdzd2	UTSW	15	12592177	missense	probably damaging	1.00
R5488:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5489:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5588:Pdzd2	UTSW	15	12374281	missense	possibly damaging	0.48
R5605:Pdzd2	UTSW	15	12592350	nonsense	probably null
R5704:Pdzd2	UTSW	15	12385675	missense	probably benign	0.02
R5858:Pdzd2	UTSW	15	12442589	missense	probably damaging	0.97
R6048:Pdzd2	UTSW	15	12592570	splice site	probably null
R6222:Pdzd2	UTSW	15	12374566	missense	probably damaging	1.00
R6311:Pdzd2	UTSW	15	12458188	missense	probably damaging	1.00
R6734:Pdzd2	UTSW	15	12592465	missense	probably damaging	1.00
R6897:Pdzd2	UTSW	15	12385865	missense	probably damaging	1.00
R6900:Pdzd2	UTSW	15	12374037	missense	probably benign
R6955:Pdzd2	UTSW	15	12401464	missense	probably damaging	1.00
R6959:Pdzd2	UTSW	15	12375907	missense	probably benign	0.17
R6992:Pdzd2	UTSW	15	12457859	missense	probably damaging	1.00
R7014:Pdzd2	UTSW	15	12372561	missense	probably benign	0.13
R7014:Pdzd2	UTSW	15	12372975	missense	probably benign	0.14
R7110:Pdzd2	UTSW	15	12368013	missense	probably damaging	1.00
R7180:Pdzd2	UTSW	15	12376123	missense	probably damaging	0.99
R7228:Pdzd2	UTSW	15	12372973	missense	probably benign	0.01
R7228:Pdzd2	UTSW	15	12458145	nonsense	probably null
R7317:Pdzd2	UTSW	15	12592243	missense	probably damaging	1.00
R7322:Pdzd2	UTSW	15	12437162	missense	probably damaging	1.00
R7349:Pdzd2	UTSW	15	12399205	missense	probably damaging	1.00
R7600:Pdzd2	UTSW	15	12372734	missense	probably damaging	1.00
R7663:Pdzd2	UTSW	15	12373203	missense	probably damaging	1.00
R7712:Pdzd2	UTSW	15	12407336	missense	probably damaging	1.00
R7716:Pdzd2	UTSW	15	12373374	missense	possibly damaging	0.63
R7740:Pdzd2	UTSW	15	12374016	missense	probably benign	0.00
R7748:Pdzd2	UTSW	15	12385786	missense	possibly damaging	0.60
R8017:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8019:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8108:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8109:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8110:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8111:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8145:Pdzd2	UTSW	15	12407372	missense	probably benign	0.37
R8220:Pdzd2	UTSW	15	12592163	missense	probably damaging	0.99
R8278:Pdzd2	UTSW	15	12375909	missense	probably benign
R8768:Pdzd2	UTSW	15	12437166	missense	probably damaging	1.00
R8879:Pdzd2	UTSW	15	12402319	missense	probably damaging	1.00
R9019:Pdzd2	UTSW	15	12375526	missense	probably damaging	1.00
R9030:Pdzd2	UTSW	15	12374299	missense	probably benign	0.02
R9061:Pdzd2	UTSW	15	12374667	missense	possibly damaging	0.94
R9302:Pdzd2	UTSW	15	12374256	missense	possibly damaging	0.61
R9321:Pdzd2	UTSW	15	12385937	missense	probably benign	0.00
R9421:Pdzd2	UTSW	15	12375028	missense
R9515:Pdzd2	UTSW	15	12374535	missense	probably damaging	1.00
R9592:Pdzd2	UTSW	15	12458020	missense	probably damaging	1.00
R9614:Pdzd2	UTSW	15	12375400	missense	probably damaging	1.00
R9630:Pdzd2	UTSW	15	12374357	missense	probably benign	0.37
R9776:Pdzd2	UTSW	15	12457823	missense	probably benign	0.03
X0057:Pdzd2	UTSW	15	12411027	missense	probably damaging	1.00
X0063:Pdzd2	UTSW	15	12368719	missense	possibly damaging	0.77
X0066:Pdzd2	UTSW	15	12372856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GATTCTGCCTGGAGACAGTCAACG -3'
(R):5'- TTAGGAACCCACCACCAGTGGATG -3'

Sequencing Primer
(F):5'- ACAGTCAACGTCACGCTGG -3'
(R):5'- AGTCACCAGGAGACACTACTACTG -3'

Posted On

2014-01-05