Incidental Mutation 'R1099:Hspbap1'
ID97988
Institutional Source Beutler Lab
Gene Symbol Hspbap1
Ensembl Gene ENSMUSG00000022849
Gene NameHspb associated protein 1
Synonyms3830421G21Rik
MMRRC Submission 039173-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1099 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location35770375-35828477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 35824944 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 333 (F333C)
Ref Sequence ENSEMBL: ENSMUSP00000156217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023555] [ENSMUST00000231579]
Predicted Effect probably benign
Transcript: ENSMUST00000023555
SMART Domains Protein: ENSMUSP00000023555
Gene: ENSMUSG00000022849

DomainStartEndE-ValueType
JmjC 126 288 1.29e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231579
AA Change: F333C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to one of the small heat shock proteins, specifically hsp27. Hsp27 is involved with cell growth and differentiation. This encoded protein was found to be abnormally expressed in patients with intractable epilepsy, although how brain function is affected remains unknown. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca7 G T 10: 80,013,743 E1921* probably null Het
Acnat2 G A 4: 49,380,484 T298I probably benign Het
Agbl4 T C 4: 110,955,663 probably null Het
Angpt2 T A 8: 18,699,133 T323S probably damaging Het
Ano2 A G 6: 125,807,847 K299R probably damaging Het
Armc2 G T 10: 41,917,187 Q814K probably benign Het
Atp9b A C 18: 80,858,626 I263S probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Casp12 T A 9: 5,352,204 H135Q probably benign Het
Ccdc180 A G 4: 45,914,225 I621V probably benign Het
Cd160 G A 3: 96,805,840 A36V probably damaging Het
Ctcfl A T 2: 173,112,360 C315S probably damaging Het
Egflam A G 15: 7,252,422 V411A probably benign Het
Ezh1 T C 11: 101,193,808 probably null Het
Fam171a1 T A 2: 3,225,317 S371T probably benign Het
Ky G C 9: 102,537,724 W278C probably damaging Het
Lrig3 T A 10: 126,007,014 probably null Het
Map3k6 A T 4: 133,247,128 S580C probably damaging Het
Mark2 T C 19: 7,277,425 T219A probably benign Het
Mbd5 A G 2: 49,258,144 I789V probably benign Het
Myo18a T A 11: 77,818,901 probably null Het
Nos1 A G 5: 117,923,395 T929A probably damaging Het
Olfr373 T A 8: 72,100,659 S300T probably benign Het
Olfr434 T C 6: 43,217,624 F237S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Palmd T C 3: 116,923,225 N541S possibly damaging Het
Pdzd2 A G 15: 12,373,087 S2321P probably damaging Het
Prdm8 T G 5: 98,183,502 I71S probably damaging Het
Prkg1 A C 19: 30,571,612 S654R probably benign Het
Psmf1 A T 2: 151,718,670 H260Q probably damaging Het
Rp1 A T 1: 4,352,290 I179N possibly damaging Het
Rreb1 A G 13: 37,948,891 K1681E probably benign Het
Rtn1 A T 12: 72,304,467 probably null Het
Scaf4 T A 16: 90,263,098 I37F unknown Het
Sema4c A G 1: 36,552,110 S383P probably damaging Het
Shc4 G T 2: 125,722,844 D178E probably benign Het
Slc2a5 A G 4: 150,142,179 N366S probably benign Het
Slc6a3 A G 13: 73,567,641 N465S probably benign Het
Tbc1d9b C A 11: 50,146,308 D261E probably benign Het
Tdrd3 A T 14: 87,487,239 T359S probably damaging Het
Thap3 T C 4: 151,983,331 M97V probably benign Het
Thg1l T A 11: 45,954,161 Q88L possibly damaging Het
Tjp3 T C 10: 81,273,823 T849A probably benign Het
Tomm70a G T 16: 57,142,817 D400Y probably damaging Het
Trak2 T C 1: 58,921,841 I177V probably benign Het
Trim66 T C 7: 109,475,454 I533M probably benign Het
Ush2a T A 1: 188,648,348 Y2285N probably benign Het
Ush2a C T 1: 188,864,639 P3859S probably damaging Het
Other mutations in Hspbap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hspbap1 APN 16 35814061 splice site probably benign
IGL01377:Hspbap1 APN 16 35825311 missense possibly damaging 0.48
IGL03070:Hspbap1 APN 16 35818726 missense probably damaging 0.96
R1346:Hspbap1 UTSW 16 35801665 missense probably damaging 1.00
R1532:Hspbap1 UTSW 16 35825303 missense probably damaging 1.00
R1848:Hspbap1 UTSW 16 35818764 critical splice donor site probably null
R1867:Hspbap1 UTSW 16 35801564 missense possibly damaging 0.77
R4512:Hspbap1 UTSW 16 35787241 missense probably damaging 0.98
R4718:Hspbap1 UTSW 16 35787322 missense probably benign 0.07
R5553:Hspbap1 UTSW 16 35801597 missense probably damaging 1.00
R5590:Hspbap1 UTSW 16 35801663 missense probably damaging 1.00
R6151:Hspbap1 UTSW 16 35817222 missense probably damaging 1.00
R6612:Hspbap1 UTSW 16 35801591 missense probably damaging 1.00
R7253:Hspbap1 UTSW 16 35817230 missense unknown
R7314:Hspbap1 UTSW 16 35825171 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAAAGCATGGGTCTGCCTTCTG -3'
(R):5'- TGCAAAGTGTCCTCCATTACTGCTG -3'

Sequencing Primer
(F):5'- TTTCCTCAGGAAGAGGACCAC -3'
(R):5'- ACTGCTGACAGATTCTTCGC -3'
Posted On2014-01-05