Incidental Mutation 'R1099:Tomm70a'
ID97990
Institutional Source Beutler Lab
Gene Symbol Tomm70a
Ensembl Gene ENSMUSG00000022752
Gene Nametranslocase of outer mitochondrial membrane 70A
SynonymsTomm70a, D16Wsu109e, D16Ium22e, Tom70, 2610044B22Rik, D16Ium22
MMRRC Submission 039173-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1099 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location57121703-57156705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 57142817 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 400 (D400Y)
Ref Sequence ENSEMBL: ENSMUSP00000129186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166897]
Predicted Effect probably damaging
Transcript: ENSMUST00000166897
AA Change: D400Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129186
Gene: ENSMUSG00000022752
AA Change: D400Y

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 98 108 N/A INTRINSIC
TPR 117 150 1.04e-7 SMART
TPR 156 189 1.97e-3 SMART
TPR 190 223 1.6e1 SMART
low complexity region 278 291 N/A INTRINSIC
TPR 332 365 1.17e1 SMART
TPR 370 403 3.5e0 SMART
TPR 404 437 3.32e-1 SMART
TPR 445 478 7.49e1 SMART
TPR 479 512 9.39e-1 SMART
TPR 513 547 9.48e1 SMART
TPR 548 581 4.03e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231298
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an import receptor of the outer mitochondrial membrane that is part of the translocase of the outer membrane complex. This protein is involved in the import of mitochondrial precursor proteins. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca7 G T 10: 80,013,743 E1921* probably null Het
Acnat2 G A 4: 49,380,484 T298I probably benign Het
Agbl4 T C 4: 110,955,663 probably null Het
Angpt2 T A 8: 18,699,133 T323S probably damaging Het
Ano2 A G 6: 125,807,847 K299R probably damaging Het
Armc2 G T 10: 41,917,187 Q814K probably benign Het
Atp9b A C 18: 80,858,626 I263S probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Casp12 T A 9: 5,352,204 H135Q probably benign Het
Ccdc180 A G 4: 45,914,225 I621V probably benign Het
Cd160 G A 3: 96,805,840 A36V probably damaging Het
Ctcfl A T 2: 173,112,360 C315S probably damaging Het
Egflam A G 15: 7,252,422 V411A probably benign Het
Ezh1 T C 11: 101,193,808 probably null Het
Fam171a1 T A 2: 3,225,317 S371T probably benign Het
Hspbap1 T G 16: 35,824,944 F333C probably damaging Het
Ky G C 9: 102,537,724 W278C probably damaging Het
Lrig3 T A 10: 126,007,014 probably null Het
Map3k6 A T 4: 133,247,128 S580C probably damaging Het
Mark2 T C 19: 7,277,425 T219A probably benign Het
Mbd5 A G 2: 49,258,144 I789V probably benign Het
Myo18a T A 11: 77,818,901 probably null Het
Nos1 A G 5: 117,923,395 T929A probably damaging Het
Olfr373 T A 8: 72,100,659 S300T probably benign Het
Olfr434 T C 6: 43,217,624 F237S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Palmd T C 3: 116,923,225 N541S possibly damaging Het
Pdzd2 A G 15: 12,373,087 S2321P probably damaging Het
Prdm8 T G 5: 98,183,502 I71S probably damaging Het
Prkg1 A C 19: 30,571,612 S654R probably benign Het
Psmf1 A T 2: 151,718,670 H260Q probably damaging Het
Rp1 A T 1: 4,352,290 I179N possibly damaging Het
Rreb1 A G 13: 37,948,891 K1681E probably benign Het
Rtn1 A T 12: 72,304,467 probably null Het
Scaf4 T A 16: 90,263,098 I37F unknown Het
Sema4c A G 1: 36,552,110 S383P probably damaging Het
Shc4 G T 2: 125,722,844 D178E probably benign Het
Slc2a5 A G 4: 150,142,179 N366S probably benign Het
Slc6a3 A G 13: 73,567,641 N465S probably benign Het
Tbc1d9b C A 11: 50,146,308 D261E probably benign Het
Tdrd3 A T 14: 87,487,239 T359S probably damaging Het
Thap3 T C 4: 151,983,331 M97V probably benign Het
Thg1l T A 11: 45,954,161 Q88L possibly damaging Het
Tjp3 T C 10: 81,273,823 T849A probably benign Het
Trak2 T C 1: 58,921,841 I177V probably benign Het
Trim66 T C 7: 109,475,454 I533M probably benign Het
Ush2a T A 1: 188,648,348 Y2285N probably benign Het
Ush2a C T 1: 188,864,639 P3859S probably damaging Het
Other mutations in Tomm70a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Tomm70a APN 16 57149810 splice site probably benign
IGL01064:Tomm70a APN 16 57152612 missense probably damaging 0.99
IGL01597:Tomm70a APN 16 57133188 missense probably benign 0.00
IGL02248:Tomm70a APN 16 57138102 missense probably benign 0.33
IGL02560:Tomm70a APN 16 57149849 missense probably benign 0.33
IGL03328:Tomm70a APN 16 57144787 missense probably damaging 0.99
IGL03335:Tomm70a APN 16 57149926 missense probably damaging 1.00
R0164:Tomm70a UTSW 16 57147821 missense probably damaging 0.96
R0164:Tomm70a UTSW 16 57147821 missense probably damaging 0.96
R0196:Tomm70a UTSW 16 57146100 missense probably benign 0.03
R0417:Tomm70a UTSW 16 57149903 missense probably benign 0.28
R0763:Tomm70a UTSW 16 57122172 missense probably benign 0.30
R1680:Tomm70a UTSW 16 57121961 missense unknown
R2081:Tomm70a UTSW 16 57140758 missense probably damaging 0.99
R2127:Tomm70a UTSW 16 57121871 missense unknown
R3033:Tomm70a UTSW 16 57122025 missense probably damaging 1.00
R4287:Tomm70a UTSW 16 57140622 missense probably damaging 1.00
R5029:Tomm70a UTSW 16 57122151 missense probably benign
R5210:Tomm70a UTSW 16 57133251 critical splice donor site probably null
R5214:Tomm70a UTSW 16 57121937 missense unknown
R5586:Tomm70a UTSW 16 57122130 missense probably damaging 1.00
R5744:Tomm70a UTSW 16 57121839 start gained probably benign
R5872:Tomm70a UTSW 16 57144742 missense probably benign 0.06
R6256:Tomm70a UTSW 16 57152692 missense probably benign 0.05
R6699:Tomm70a UTSW 16 57142802 missense probably benign 0.02
R6902:Tomm70a UTSW 16 57138081 missense probably damaging 0.96
R7106:Tomm70a UTSW 16 57140758 missense probably damaging 0.99
R7378:Tomm70a UTSW 16 57146044 nonsense probably null
R7817:Tomm70a UTSW 16 57144773 missense probably damaging 1.00
R8002:Tomm70a UTSW 16 57136734 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCCGAAATCTGTAATAACCAACCT -3'
(R):5'- ACCTGATACCTCTGGCTTCCCTG -3'

Sequencing Primer
(F):5'- TGTAGCTTCGAGCAAATGCC -3'
(R):5'- tcgggaggcagaggcag -3'
Posted On2014-01-05