Incidental Mutation 'R1099:Prkg1'
ID98005
Institutional Source Beutler Lab
Gene Symbol Prkg1
Ensembl Gene ENSMUSG00000052920
Gene Nameprotein kinase, cGMP-dependent, type I
SynonymsPrkgr1b, Prkg1b
MMRRC Submission 039173-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R1099 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location30567551-31765033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30571612 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 654 (S654R)
Ref Sequence ENSEMBL: ENSMUSP00000073268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]
Predicted Effect probably benign
Transcript: ENSMUST00000065067
AA Change: S639R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: S639R

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073581
AA Change: S654R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: S654R

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183135
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca7 G T 10: 80,013,743 E1921* probably null Het
Acnat2 G A 4: 49,380,484 T298I probably benign Het
Agbl4 T C 4: 110,955,663 probably null Het
Angpt2 T A 8: 18,699,133 T323S probably damaging Het
Ano2 A G 6: 125,807,847 K299R probably damaging Het
Armc2 G T 10: 41,917,187 Q814K probably benign Het
Atp9b A C 18: 80,858,626 I263S probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Casp12 T A 9: 5,352,204 H135Q probably benign Het
Ccdc180 A G 4: 45,914,225 I621V probably benign Het
Cd160 G A 3: 96,805,840 A36V probably damaging Het
Ctcfl A T 2: 173,112,360 C315S probably damaging Het
Egflam A G 15: 7,252,422 V411A probably benign Het
Ezh1 T C 11: 101,193,808 probably null Het
Fam171a1 T A 2: 3,225,317 S371T probably benign Het
Hspbap1 T G 16: 35,824,944 F333C probably damaging Het
Ky G C 9: 102,537,724 W278C probably damaging Het
Lrig3 T A 10: 126,007,014 probably null Het
Map3k6 A T 4: 133,247,128 S580C probably damaging Het
Mark2 T C 19: 7,277,425 T219A probably benign Het
Mbd5 A G 2: 49,258,144 I789V probably benign Het
Myo18a T A 11: 77,818,901 probably null Het
Nos1 A G 5: 117,923,395 T929A probably damaging Het
Olfr373 T A 8: 72,100,659 S300T probably benign Het
Olfr434 T C 6: 43,217,624 F237S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Palmd T C 3: 116,923,225 N541S possibly damaging Het
Pdzd2 A G 15: 12,373,087 S2321P probably damaging Het
Prdm8 T G 5: 98,183,502 I71S probably damaging Het
Psmf1 A T 2: 151,718,670 H260Q probably damaging Het
Rp1 A T 1: 4,352,290 I179N possibly damaging Het
Rreb1 A G 13: 37,948,891 K1681E probably benign Het
Rtn1 A T 12: 72,304,467 probably null Het
Scaf4 T A 16: 90,263,098 I37F unknown Het
Sema4c A G 1: 36,552,110 S383P probably damaging Het
Shc4 G T 2: 125,722,844 D178E probably benign Het
Slc2a5 A G 4: 150,142,179 N366S probably benign Het
Slc6a3 A G 13: 73,567,641 N465S probably benign Het
Tbc1d9b C A 11: 50,146,308 D261E probably benign Het
Tdrd3 A T 14: 87,487,239 T359S probably damaging Het
Thap3 T C 4: 151,983,331 M97V probably benign Het
Thg1l T A 11: 45,954,161 Q88L possibly damaging Het
Tjp3 T C 10: 81,273,823 T849A probably benign Het
Tomm70a G T 16: 57,142,817 D400Y probably damaging Het
Trak2 T C 1: 58,921,841 I177V probably benign Het
Trim66 T C 7: 109,475,454 I533M probably benign Het
Ush2a T A 1: 188,648,348 Y2285N probably benign Het
Ush2a C T 1: 188,864,639 P3859S probably damaging Het
Other mutations in Prkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Prkg1 APN 19 31302340 missense probably benign 0.02
IGL00481:Prkg1 APN 19 30571622 missense probably benign 0.28
IGL00517:Prkg1 APN 19 30894668 missense probably benign
IGL00782:Prkg1 APN 19 30578753 splice site probably benign
IGL01070:Prkg1 APN 19 30569343 splice site probably benign
IGL01106:Prkg1 APN 19 30585278 missense probably benign 0.05
IGL01783:Prkg1 APN 19 30624689 missense probably damaging 1.00
IGL02135:Prkg1 APN 19 30993076 missense probably benign 0.13
IGL02492:Prkg1 APN 19 30724202 missense probably damaging 1.00
IGL02543:Prkg1 APN 19 30624734 missense possibly damaging 0.62
IGL02733:Prkg1 APN 19 31302301 missense probably damaging 1.00
IGL03129:Prkg1 APN 19 30585281 nonsense probably null
IGL03220:Prkg1 APN 19 30569237 utr 3 prime probably benign
R0363:Prkg1 UTSW 19 31664196 missense probably damaging 1.00
R0693:Prkg1 UTSW 19 30594978 missense probably benign
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1556:Prkg1 UTSW 19 30624743 missense probably benign
R1738:Prkg1 UTSW 19 30786922 missense possibly damaging 0.48
R1974:Prkg1 UTSW 19 31585695 missense probably damaging 1.00
R2011:Prkg1 UTSW 19 31664142 missense possibly damaging 0.94
R2207:Prkg1 UTSW 19 30578860 missense probably damaging 1.00
R2270:Prkg1 UTSW 19 30578631 missense probably benign 0.27
R3009:Prkg1 UTSW 19 31664112 missense possibly damaging 0.74
R4078:Prkg1 UTSW 19 31585578 missense probably damaging 1.00
R4355:Prkg1 UTSW 19 30569229 utr 3 prime probably benign
R4652:Prkg1 UTSW 19 30595012 missense probably damaging 1.00
R4669:Prkg1 UTSW 19 31664239 missense probably damaging 0.98
R4684:Prkg1 UTSW 19 31664179 nonsense probably null
R4789:Prkg1 UTSW 19 31585645 missense probably damaging 0.97
R4826:Prkg1 UTSW 19 31764606 missense possibly damaging 0.93
R4936:Prkg1 UTSW 19 30586375 missense probably benign 0.37
R5625:Prkg1 UTSW 19 31764762 missense possibly damaging 0.95
R5819:Prkg1 UTSW 19 31585672 missense probably benign 0.02
R5855:Prkg1 UTSW 19 30894694 missense possibly damaging 0.93
R5882:Prkg1 UTSW 19 31585697 missense probably damaging 1.00
R5965:Prkg1 UTSW 19 30724156 splice site probably null
R5968:Prkg1 UTSW 19 30592924 missense probably damaging 1.00
R6310:Prkg1 UTSW 19 30569251 missense probably damaging 1.00
R6433:Prkg1 UTSW 19 30781346 missense probably benign 0.21
R6702:Prkg1 UTSW 19 30993084 missense probably benign 0.00
R6750:Prkg1 UTSW 19 31764561 missense probably benign 0.41
R6894:Prkg1 UTSW 19 30624774 nonsense probably null
R7155:Prkg1 UTSW 19 31302301 missense probably damaging 1.00
R7165:Prkg1 UTSW 19 30585199 missense probably damaging 1.00
R7238:Prkg1 UTSW 19 30624690 missense probably damaging 1.00
R7428:Prkg1 UTSW 19 30578835 missense probably damaging 1.00
R7748:Prkg1 UTSW 19 30993091 missense possibly damaging 0.90
R7804:Prkg1 UTSW 19 30578632 missense probably benign 0.00
R7804:Prkg1 UTSW 19 30624770 missense possibly damaging 0.92
R7893:Prkg1 UTSW 19 30586367 missense probably damaging 0.99
R8304:Prkg1 UTSW 19 30724184 missense possibly damaging 0.75
X0011:Prkg1 UTSW 19 30993121 missense probably damaging 1.00
Z1177:Prkg1 UTSW 19 31302373 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGACTGGACATACACGCTTGCTG -3'
(R):5'- TGCATGGCTGCTTTCTACCACG -3'

Sequencing Primer
(F):5'- GGACATACACGCTTGCTGTAAATG -3'
(R):5'- TAGCAGAGAGGCAGTGTCTT -3'
Posted On2014-01-05