Mutagenetix > Incidental Mutation

Incidental Mutation 'R1099:Prkg1'

98005

Institutional Source

Beutler Lab

Gene Symbol

Prkg1

Ensembl Gene

ENSMUSG00000052920

Gene Name

protein kinase, cGMP-dependent, type I

Synonyms

Prkgr1b, Prkg1b

MMRRC Submission

039173-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.516) question?

Stock #

R1099 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30567551-31765033 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 30571612 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 654 (S654R)

Ref Sequence

ENSEMBL: ENSMUSP00000073268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]

AlphaFold

P0C605

Predicted Effect

probably benign
Transcript: ENSMUST00000065067
AA Change: S639R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: S639R

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
cNMP	103	216	6.37e-27	SMART
cNMP	221	343	1.23e-33	SMART
S_TKc	360	619	5.25e-91	SMART
S_TK_X	620	671	1.55e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073581
AA Change: S654R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: S654R

Domain	Start	End	E-Value	Type
coiled coil region	10	62	N/A	INTRINSIC
cNMP	118	231	6.37e-27	SMART
cNMP	236	358	1.23e-33	SMART
S_TKc	375	634	5.25e-91	SMART
S_TK_X	635	686	1.55e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182459

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183135

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abca7	G	T	10: 80,013,743	E1921*	probably null	Het
Acnat2	G	A	4: 49,380,484	T298I	probably benign	Het
Agbl4	T	C	4: 110,955,663		probably null	Het
Angpt2	T	A	8: 18,699,133	T323S	probably damaging	Het
Ano2	A	G	6: 125,807,847	K299R	probably damaging	Het
Armc2	G	T	10: 41,917,187	Q814K	probably benign	Het
Atp9b	A	C	18: 80,858,626	I263S	probably damaging	Het
Cadps2	A	G	6: 23,599,479	I276T	probably damaging	Het
Casp12	T	A	9: 5,352,204	H135Q	probably benign	Het
Ccdc180	A	G	4: 45,914,225	I621V	probably benign	Het
Cd160	G	A	3: 96,805,840	A36V	probably damaging	Het
Ctcfl	A	T	2: 173,112,360	C315S	probably damaging	Het
Egflam	A	G	15: 7,252,422	V411A	probably benign	Het
Ezh1	T	C	11: 101,193,808		probably null	Het
Fam171a1	T	A	2: 3,225,317	S371T	probably benign	Het
Hspbap1	T	G	16: 35,824,944	F333C	probably damaging	Het
Ky	G	C	9: 102,537,724	W278C	probably damaging	Het
Lrig3	T	A	10: 126,007,014		probably null	Het
Map3k6	A	T	4: 133,247,128	S580C	probably damaging	Het
Mark2	T	C	19: 7,277,425	T219A	probably benign	Het
Mbd5	A	G	2: 49,258,144	I789V	probably benign	Het
Myo18a	T	A	11: 77,818,901		probably null	Het
Nos1	A	G	5: 117,923,395	T929A	probably damaging	Het
Olfr373	T	A	8: 72,100,659	S300T	probably benign	Het
Olfr434	T	C	6: 43,217,624	F237S	probably damaging	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Palmd	T	C	3: 116,923,225	N541S	possibly damaging	Het
Pdzd2	A	G	15: 12,373,087	S2321P	probably damaging	Het
Prdm8	T	G	5: 98,183,502	I71S	probably damaging	Het
Psmf1	A	T	2: 151,718,670	H260Q	probably damaging	Het
Rp1	A	T	1: 4,352,290	I179N	possibly damaging	Het
Rreb1	A	G	13: 37,948,891	K1681E	probably benign	Het
Rtn1	A	T	12: 72,304,467		probably null	Het
Scaf4	T	A	16: 90,263,098	I37F	unknown	Het
Sema4c	A	G	1: 36,552,110	S383P	probably damaging	Het
Shc4	G	T	2: 125,722,844	D178E	probably benign	Het
Slc2a5	A	G	4: 150,142,179	N366S	probably benign	Het
Slc6a3	A	G	13: 73,567,641	N465S	probably benign	Het
Tbc1d9b	C	A	11: 50,146,308	D261E	probably benign	Het
Tdrd3	A	T	14: 87,487,239	T359S	probably damaging	Het
Thap3	T	C	4: 151,983,331	M97V	probably benign	Het
Thg1l	T	A	11: 45,954,161	Q88L	possibly damaging	Het
Tjp3	T	C	10: 81,273,823	T849A	probably benign	Het
Tomm70a	G	T	16: 57,142,817	D400Y	probably damaging	Het
Trak2	T	C	1: 58,921,841	I177V	probably benign	Het
Trim66	T	C	7: 109,475,454	I533M	probably benign	Het
Ush2a	T	A	1: 188,648,348	Y2285N	probably benign	Het
Ush2a	C	T	1: 188,864,639	P3859S	probably damaging	Het

Other mutations in Prkg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Prkg1	APN	19	31302340	missense	probably benign	0.02
IGL00481:Prkg1	APN	19	30571622	missense	probably benign	0.28
IGL00517:Prkg1	APN	19	30894668	missense	probably benign
IGL00782:Prkg1	APN	19	30578753	splice site	probably benign
IGL01070:Prkg1	APN	19	30569343	splice site	probably benign
IGL01106:Prkg1	APN	19	30585278	missense	probably benign	0.05
IGL01783:Prkg1	APN	19	30624689	missense	probably damaging	1.00
IGL02135:Prkg1	APN	19	30993076	missense	probably benign	0.13
IGL02492:Prkg1	APN	19	30724202	missense	probably damaging	1.00
IGL02543:Prkg1	APN	19	30624734	missense	possibly damaging	0.62
IGL02733:Prkg1	APN	19	31302301	missense	probably damaging	1.00
IGL03129:Prkg1	APN	19	30585281	nonsense	probably null
IGL03220:Prkg1	APN	19	30569237	utr 3 prime	probably benign
R0363:Prkg1	UTSW	19	31664196	missense	probably damaging	1.00
R0693:Prkg1	UTSW	19	30594978	missense	probably benign
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1556:Prkg1	UTSW	19	30624743	missense	probably benign
R1738:Prkg1	UTSW	19	30786922	missense	possibly damaging	0.48
R1974:Prkg1	UTSW	19	31585695	missense	probably damaging	1.00
R2011:Prkg1	UTSW	19	31664142	missense	possibly damaging	0.94
R2207:Prkg1	UTSW	19	30578860	missense	probably damaging	1.00
R2270:Prkg1	UTSW	19	30578631	missense	probably benign	0.27
R3009:Prkg1	UTSW	19	31664112	missense	possibly damaging	0.74
R4078:Prkg1	UTSW	19	31585578	missense	probably damaging	1.00
R4355:Prkg1	UTSW	19	30569229	utr 3 prime	probably benign
R4652:Prkg1	UTSW	19	30595012	missense	probably damaging	1.00
R4669:Prkg1	UTSW	19	31664239	missense	probably damaging	0.98
R4684:Prkg1	UTSW	19	31664179	nonsense	probably null
R4789:Prkg1	UTSW	19	31585645	missense	probably damaging	0.97
R4826:Prkg1	UTSW	19	31764606	missense	possibly damaging	0.93
R4936:Prkg1	UTSW	19	30586375	missense	probably benign	0.37
R5625:Prkg1	UTSW	19	31764762	missense	possibly damaging	0.95
R5819:Prkg1	UTSW	19	31585672	missense	probably benign	0.02
R5855:Prkg1	UTSW	19	30894694	missense	possibly damaging	0.93
R5882:Prkg1	UTSW	19	31585697	missense	probably damaging	1.00
R5965:Prkg1	UTSW	19	30724156	splice site	probably null
R5968:Prkg1	UTSW	19	30592924	missense	probably damaging	1.00
R6310:Prkg1	UTSW	19	30569251	missense	probably damaging	1.00
R6433:Prkg1	UTSW	19	30781346	missense	probably benign	0.21
R6702:Prkg1	UTSW	19	30993084	missense	probably benign	0.00
R6750:Prkg1	UTSW	19	31764561	missense	probably benign	0.41
R6894:Prkg1	UTSW	19	30624774	nonsense	probably null
R7155:Prkg1	UTSW	19	31302301	missense	probably damaging	1.00
R7165:Prkg1	UTSW	19	30585199	missense	probably damaging	1.00
R7238:Prkg1	UTSW	19	30624690	missense	probably damaging	1.00
R7428:Prkg1	UTSW	19	30578835	missense	probably damaging	1.00
R7748:Prkg1	UTSW	19	30993091	missense	possibly damaging	0.90
R7804:Prkg1	UTSW	19	30578632	missense	probably benign	0.00
R7804:Prkg1	UTSW	19	30624770	missense	possibly damaging	0.92
R7893:Prkg1	UTSW	19	30586367	missense	probably damaging	0.99
R8304:Prkg1	UTSW	19	30724184	missense	possibly damaging	0.75
R8497:Prkg1	UTSW	19	31302309	missense	probably damaging	1.00
R8676:Prkg1	UTSW	19	31764746	missense	probably damaging	0.98
R9318:Prkg1	UTSW	19	30571638	missense	probably benign	0.09
R9694:Prkg1	UTSW	19	30786971	missense	possibly damaging	0.84
X0011:Prkg1	UTSW	19	30993121	missense	probably damaging	1.00
Z1177:Prkg1	UTSW	19	31302373	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AGACTGGACATACACGCTTGCTG -3'
(R):5'- TGCATGGCTGCTTTCTACCACG -3'

Sequencing Primer
(F):5'- GGACATACACGCTTGCTGTAAATG -3'
(R):5'- TAGCAGAGAGGCAGTGTCTT -3'

Posted On

2014-01-05