Incidental Mutation 'R1004:Poli'
ID98011
Institutional Source Beutler Lab
Gene Symbol Poli
Ensembl Gene ENSMUSG00000038425
Gene Namepolymerase (DNA directed), iota
SynonymsRad30b
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1004 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location70508680-70530620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70525438 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 75 (Q75L)
Ref Sequence ENSEMBL: ENSMUSP00000123964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043286] [ENSMUST00000121674] [ENSMUST00000159389] [ENSMUST00000160713] [ENSMUST00000161542]
Predicted Effect probably benign
Transcript: ENSMUST00000043286
AA Change: Q98L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039869
Gene: ENSMUSG00000038425
AA Change: Q98L

DomainStartEndE-ValueType
Pfam:IMS 1 168 5.4e-39 PFAM
Pfam:IMS_HHH 180 212 1.2e-9 PFAM
Pfam:IMS_C 247 379 1.7e-12 PFAM
PDB:2KWV|A 444 489 8e-23 PDB
low complexity region 532 546 N/A INTRINSIC
PDB:3AI4|A 623 674 4e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000121674
AA Change: Q161L

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112563
Gene: ENSMUSG00000038425
AA Change: Q161L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:IMS 53 231 1e-47 PFAM
Pfam:IMS_HHH 243 275 1.5e-9 PFAM
Pfam:IMS_C 312 441 2.5e-14 PFAM
PDB:2KWV|A 507 552 8e-23 PDB
low complexity region 595 609 N/A INTRINSIC
PDB:3AI4|A 686 737 5e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000159389
AA Change: Q75L

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123964
Gene: ENSMUSG00000038425
AA Change: Q75L

DomainStartEndE-ValueType
Pfam:IMS 1 145 1.8e-29 PFAM
Pfam:IMS_HHH 157 189 1.7e-9 PFAM
Pfam:IMS_C 224 356 2.4e-12 PFAM
PDB:2KWV|A 421 466 7e-23 PDB
low complexity region 509 523 N/A INTRINSIC
PDB:3AI4|A 600 651 3e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160713
AA Change: Q98L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125467
Gene: ENSMUSG00000038425
AA Change: Q98L

DomainStartEndE-ValueType
Pfam:IMS 1 127 5.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161542
AA Change: Q98L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124877
Gene: ENSMUSG00000038425
AA Change: Q98L

DomainStartEndE-ValueType
Pfam:IMS 1 168 5.4e-39 PFAM
Pfam:IMS_HHH 180 212 1.2e-9 PFAM
Pfam:IMS_C 247 379 1.7e-12 PFAM
PDB:2KWV|A 444 489 8e-23 PDB
low complexity region 532 546 N/A INTRINSIC
PDB:3AI4|A 623 674 4e-26 PDB
Meta Mutation Damage Score 0.2524 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation show normal somatic hypermutation of immunoglobulin variable genes and no significant increase in UV-induced epithelial skin tumor formation relative to controls; in contrast, formation of mesenchymal tumors by chronic UV irradiation is enhanced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Poli
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Poli APN 18 70525490 missense probably damaging 1.00
IGL01506:Poli APN 18 70509731 missense probably benign
IGL01958:Poli APN 18 70526586 missense possibly damaging 0.46
IGL02375:Poli APN 18 70523292 missense probably damaging 1.00
IGL02385:Poli APN 18 70526574 missense possibly damaging 0.93
IGL02480:Poli APN 18 70525406 missense probably benign 0.04
R0113:Poli UTSW 18 70528758 missense probably damaging 1.00
R0184:Poli UTSW 18 70522731 missense probably damaging 1.00
R0348:Poli UTSW 18 70523381 missense probably benign 0.00
R0710:Poli UTSW 18 70522890 splice site probably null
R1264:Poli UTSW 18 70517503 missense probably benign 0.05
R1660:Poli UTSW 18 70509464 missense probably damaging 0.99
R1992:Poli UTSW 18 70508987 missense probably damaging 0.98
R2915:Poli UTSW 18 70522700 critical splice donor site probably null
R4531:Poli UTSW 18 70517477 missense probably benign 0.41
R4816:Poli UTSW 18 70522751 missense probably damaging 1.00
R5393:Poli UTSW 18 70517428 nonsense probably null
R5404:Poli UTSW 18 70509432 missense probably benign 0.15
R5559:Poli UTSW 18 70509285 missense probably benign 0.02
R5957:Poli UTSW 18 70517440 missense probably benign
R6045:Poli UTSW 18 70517469 missense possibly damaging 0.75
R6385:Poli UTSW 18 70530001 start gained probably benign
R6807:Poli UTSW 18 70530151 splice site probably null
R7024:Poli UTSW 18 70516849 missense possibly damaging 0.68
R7067:Poli UTSW 18 70509417 nonsense probably null
R7452:Poli UTSW 18 70508978 missense possibly damaging 0.94
R7653:Poli UTSW 18 70509627 missense probably benign
R7685:Poli UTSW 18 70525519 missense probably benign 0.13
R7857:Poli UTSW 18 70509154 missense probably benign 0.01
R7872:Poli UTSW 18 70522820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCCTTGACGAGACTGGCAAGAC -3'
(R):5'- GAGGACCTTGTCCAAGATGCTGTG -3'

Sequencing Primer
(F):5'- ACTGGCAAGACTTCATTTTGGC -3'
(R):5'- cacacacacaatactacacagac -3'
Posted On2014-01-05