Incidental Mutation 'R1004:Nxf1'
ID98015
Institutional Source Beutler Lab
Gene Symbol Nxf1
Ensembl Gene ENSMUSG00000010097
Gene Namenuclear RNA export factor 1
SynonymsTip associated protein, Mex67, TAP, Mvb1
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1004 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8757073-8772475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8764317 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 119 (T119S)
Ref Sequence ENSEMBL: ENSMUSP00000139351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010241] [ENSMUST00000183939] [ENSMUST00000184756] [ENSMUST00000184970]
AlphaFold Q99JX7
Predicted Effect probably benign
Transcript: ENSMUST00000010241
AA Change: T255S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010241
Gene: ENSMUSG00000010097
AA Change: T255S

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 115 198 7.6e-42 PFAM
low complexity region 258 274 N/A INTRINSIC
LRRcap 333 351 1.44e0 SMART
Pfam:NTF2 385 535 1.3e-29 PFAM
TAP_C 555 618 1.85e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183780
Predicted Effect probably benign
Transcript: ENSMUST00000183939
AA Change: T119S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139351
Gene: ENSMUSG00000010097
AA Change: T119S

DomainStartEndE-ValueType
Pfam:Tap-RNA_bind 1 63 5.7e-28 PFAM
low complexity region 122 138 N/A INTRINSIC
Pfam:LRR_1 155 178 2.1e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184387
Predicted Effect probably benign
Transcript: ENSMUST00000184756
SMART Domains Protein: ENSMUSP00000139050
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184826
Predicted Effect probably benign
Transcript: ENSMUST00000184970
AA Change: T255S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139124
Gene: ENSMUSG00000010097
AA Change: T255S

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 112 199 2.4e-45 PFAM
low complexity region 258 274 N/A INTRINSIC
Pfam:LRR_1 291 314 3.2e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185056
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene shuttles between the nucleus and the cytoplasm and binds in vivo to poly(A)+ RNA. It is the vertebrate homologue of the yeast protein Mex67p. The encoded protein overcomes the mRNA export block caused by the presence of saturating amounts of CTE (constitutive transport element) RNA of type D retroviruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some alleles are able to suppress defects caused by retrovirus insertion mutations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Nxf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Nxf1 APN 19 8762742 missense possibly damaging 0.95
IGL02318:Nxf1 APN 19 8764150 critical splice donor site probably null
IGL03383:Nxf1 APN 19 8763697 missense probably damaging 1.00
Chance UTSW 19 8769182 missense probably damaging 1.00
Possibility UTSW 19 8767744 missense probably damaging 1.00
Probability UTSW 19 8764317 missense probably benign 0.01
R0125:Nxf1 UTSW 19 8762806 missense probably benign 0.37
R0362:Nxf1 UTSW 19 8764151 critical splice donor site probably null
R0374:Nxf1 UTSW 19 8767739 missense possibly damaging 0.86
R0403:Nxf1 UTSW 19 8765028 missense probably damaging 1.00
R0883:Nxf1 UTSW 19 8764591 missense probably damaging 1.00
R1068:Nxf1 UTSW 19 8762754 missense probably damaging 0.97
R1503:Nxf1 UTSW 19 8762436 missense probably benign
R1669:Nxf1 UTSW 19 8772131 missense possibly damaging 0.93
R1679:Nxf1 UTSW 19 8769074 missense probably benign
R4424:Nxf1 UTSW 19 8766764 utr 3 prime probably benign
R4608:Nxf1 UTSW 19 8762763 missense probably benign 0.03
R4783:Nxf1 UTSW 19 8766798 missense probably benign 0.01
R4969:Nxf1 UTSW 19 8762305 splice site probably null
R5233:Nxf1 UTSW 19 8763929 missense possibly damaging 0.67
R5370:Nxf1 UTSW 19 8772140 missense probably damaging 1.00
R6024:Nxf1 UTSW 19 8767744 missense probably damaging 1.00
R6058:Nxf1 UTSW 19 8767822 missense probably damaging 1.00
R6063:Nxf1 UTSW 19 8767787 missense possibly damaging 0.46
R6293:Nxf1 UTSW 19 8769182 missense probably damaging 1.00
R6378:Nxf1 UTSW 19 8764546 missense probably benign 0.19
R8170:Nxf1 UTSW 19 8771050 missense probably benign 0.02
R8317:Nxf1 UTSW 19 8771043 missense probably benign
R9110:Nxf1 UTSW 19 8767754 missense probably damaging 1.00
RF021:Nxf1 UTSW 19 8772309 missense probably damaging 1.00
X0024:Nxf1 UTSW 19 8763764 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGTGACATGGTCCAGCAGACTTTC -3'
(R):5'- CCACGGGGCAAATCTGTATCTCATC -3'

Sequencing Primer
(F):5'- CTTCTAGCTGATCATGAGCAAACG -3'
(R):5'- GGGGCAAATCTGTATCTCATCCTATC -3'
Posted On2014-01-05