Mutagenetix > Incidental Mutation

Incidental Mutation 'R1004:Pfpl'

98017

Institutional Source

Beutler Lab

Gene Symbol

Pfpl

Ensembl Gene

ENSMUSG00000040065

Gene Name

pore forming protein-like

Synonyms

Epcs5, Epcs50

MMRRC Submission

039114-MU

Accession Numbers

Genbank: NM_019540; MGI: 1860266

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R1004 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12427905-12432110 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12430425 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 680 (Q680L)

Ref Sequence

ENSEMBL: ENSMUSP00000126346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168148]

AlphaFold

Q5RKV8

Predicted Effect

probably benign
Transcript: ENSMUST00000168148
AA Change: Q680L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000126346
Gene: ENSMUSG00000040065
AA Change: Q680L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
MACPF	144	343	6.26e-33	SMART
transmembrane domain	643	665	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (41/41)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,151,954	I423T	possibly damaging	Het
Agbl3	A	T	6: 34,803,451	E453V	probably damaging	Het
Agxt	A	G	1: 93,135,699	M108V	possibly damaging	Het
Akap13	T	C	7: 75,687,286	I831T	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arid1a	A	G	4: 133,687,275	M1215T	unknown	Het
Cd163	G	T	6: 124,325,347	D957Y	probably damaging	Het
Ces2e	A	G	8: 104,929,738	D200G	probably damaging	Het
Cfap54	T	C	10: 93,066,696		probably benign	Het
Col11a1	A	G	3: 114,095,022		probably benign	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Dpp4	T	A	2: 62,332,640	Q754L	probably benign	Het
Ece1	A	G	4: 137,926,239	T100A	probably benign	Het
Gabbr2	C	T	4: 46,677,544	V779M	possibly damaging	Het
Gatm	C	T	2: 122,609,660		probably benign	Het
Gm20767	T	A	13: 120,155,022	D132E	probably benign	Het
Gpc2	A	G	5: 138,278,225	L213P	probably damaging	Het
Hook1	A	C	4: 96,022,287	N713H	probably benign	Het
Kdm5b	T	A	1: 134,588,904	I178K	possibly damaging	Het
Mettl9	G	A	7: 121,076,237	V287I	probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mycbp2	G	A	14: 103,140,917	T3774I	probably benign	Het
Nupl1	C	A	14: 60,247,481		probably benign	Het
Nxf1	A	T	19: 8,764,317	T119S	probably benign	Het
Oaz3	T	A	3: 94,435,043	H102L	probably damaging	Het
Olfr971	T	C	9: 39,839,980	F182S	probably benign	Het
Poli	T	A	18: 70,525,438	Q75L	probably benign	Het
Ppp2r3a	C	T	9: 101,198,630		probably null	Het
Prr30	A	G	14: 101,199,093	L11P	probably damaging	Het
Ptchd4	A	T	17: 42,377,602	Y345F	probably benign	Het
Ric1	A	G	19: 29,602,357	N1233S	probably benign	Het
Serpinb9f	TA	"TTTNA,T"	13: 33,334,242		probably benign	Het
Sh3bgrl2	C	T	9: 83,577,631		probably benign	Het
Skp1a	G	C	11: 52,237,380		probably benign	Het
Slc12a9	T	C	5: 137,322,524	K528R	probably damaging	Het
Slc22a6	A	G	19: 8,618,399	N35S	probably damaging	Het
Xrcc5	A	G	1: 72,383,778		probably benign	Het
Zfp235	T	A	7: 24,140,744	L266Q	probably damaging	Het
Zfp600	T	A	4: 146,196,533		probably benign	Het

Other mutations in Pfpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Pfpl	APN	19	12429645	missense	probably benign	0.00
IGL01298:Pfpl	APN	19	12428673	missense	possibly damaging	0.68
IGL01310:Pfpl	APN	19	12428610	missense	probably damaging	1.00
IGL02273:Pfpl	APN	19	12429963	missense	possibly damaging	0.96
IGL02532:Pfpl	APN	19	12428845	missense	probably damaging	1.00
IGL02611:Pfpl	APN	19	12430283	missense	probably benign
IGL02642:Pfpl	APN	19	12429743	missense	probably damaging	1.00
IGL02715:Pfpl	APN	19	12429781	nonsense	probably null
IGL03087:Pfpl	APN	19	12428877	missense	probably benign	0.06
IGL03223:Pfpl	APN	19	12430074	missense	probably damaging	1.00
IGL03253:Pfpl	APN	19	12430029	missense	probably damaging	0.99
pegged	UTSW	19	12429010	missense	probably damaging	1.00
D3080:Pfpl	UTSW	19	12428832	missense	probably damaging	0.98
R0276:Pfpl	UTSW	19	12429237	missense	probably damaging	1.00
R0433:Pfpl	UTSW	19	12429475	missense	probably damaging	1.00
R1510:Pfpl	UTSW	19	12429696	missense	probably benign	0.31
R1759:Pfpl	UTSW	19	12429860	missense	probably damaging	1.00
R2009:Pfpl	UTSW	19	12429955	missense	possibly damaging	0.95
R2063:Pfpl	UTSW	19	12429873	missense	probably damaging	1.00
R2201:Pfpl	UTSW	19	12430479	missense	probably benign	0.01
R2656:Pfpl	UTSW	19	12430236	missense	probably benign
R2969:Pfpl	UTSW	19	12429543	missense	probably benign	0.00
R3003:Pfpl	UTSW	19	12430326	missense	possibly damaging	0.90
R3428:Pfpl	UTSW	19	12430313	missense	probably benign	0.37
R3904:Pfpl	UTSW	19	12430437	missense	probably benign	0.00
R4049:Pfpl	UTSW	19	12429689	missense	probably damaging	1.00
R4717:Pfpl	UTSW	19	12429254	missense	probably benign	0.07
R5343:Pfpl	UTSW	19	12428688	missense	probably damaging	0.99
R5804:Pfpl	UTSW	19	12429663	missense	probably benign	0.00
R6032:Pfpl	UTSW	19	12429383	missense	probably damaging	0.99
R6032:Pfpl	UTSW	19	12429383	missense	probably damaging	0.99
R6047:Pfpl	UTSW	19	12429233	missense	probably damaging	1.00
R6106:Pfpl	UTSW	19	12429461	missense	probably damaging	0.99
R6657:Pfpl	UTSW	19	12429926	missense	probably benign	0.36
R7467:Pfpl	UTSW	19	12428514	missense	probably damaging	1.00
R7720:Pfpl	UTSW	19	12429174	missense	probably benign	0.02
R8024:Pfpl	UTSW	19	12430206	missense	possibly damaging	0.94
R8370:Pfpl	UTSW	19	12429911	missense	probably damaging	0.99
R8730:Pfpl	UTSW	19	12428580	missense	probably damaging	1.00
R8974:Pfpl	UTSW	19	12428475	missense	probably damaging	1.00
R9147:Pfpl	UTSW	19	12428440	missense	possibly damaging	0.64
R9148:Pfpl	UTSW	19	12428440	missense	possibly damaging	0.64
R9248:Pfpl	UTSW	19	12429010	missense	probably damaging	1.00
R9283:Pfpl	UTSW	19	12428856	missense	probably damaging	1.00
R9542:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9560:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9561:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9663:Pfpl	UTSW	19	12430095	missense	probably damaging	1.00
R9670:Pfpl	UTSW	19	12429743	missense	probably damaging	1.00
R9721:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9722:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9723:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9759:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9761:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9762:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
Z1176:Pfpl	UTSW	19	12429941	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTACACGAGCATCTCTGGCTCCTG -3'
(R):5'- AGCATTCCGACAATGGCTGAGAAC -3'

Sequencing Primer
(F):5'- AGAGTCCCATATCCTGGGTTAAG -3'
(R):5'- AAAAACCTTCTTTCGGTTGCG -3'

Posted On

2014-01-05