Incidental Mutation 'R1004:Pfpl'
ID98017
Institutional Source Beutler Lab
Gene Symbol Pfpl
Ensembl Gene ENSMUSG00000040065
Gene Namepore forming protein-like
SynonymsEpcs5, Epcs50
MMRRC Submission 039114-MU
Accession Numbers

Genbank: NM_019540; MGI: 1860266

Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R1004 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12427905-12432110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12430425 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 680 (Q680L)
Ref Sequence ENSEMBL: ENSMUSP00000126346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168148]
Predicted Effect probably benign
Transcript: ENSMUST00000168148
AA Change: Q680L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000126346
Gene: ENSMUSG00000040065
AA Change: Q680L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
MACPF 144 343 6.26e-33 SMART
transmembrane domain 643 665 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Pfpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pfpl APN 19 12429645 missense probably benign 0.00
IGL01298:Pfpl APN 19 12428673 missense possibly damaging 0.68
IGL01310:Pfpl APN 19 12428610 missense probably damaging 1.00
IGL02273:Pfpl APN 19 12429963 missense possibly damaging 0.96
IGL02532:Pfpl APN 19 12428845 missense probably damaging 1.00
IGL02611:Pfpl APN 19 12430283 missense probably benign
IGL02642:Pfpl APN 19 12429743 missense probably damaging 1.00
IGL02715:Pfpl APN 19 12429781 nonsense probably null
IGL03087:Pfpl APN 19 12428877 missense probably benign 0.06
IGL03223:Pfpl APN 19 12430074 missense probably damaging 1.00
IGL03253:Pfpl APN 19 12430029 missense probably damaging 0.99
D3080:Pfpl UTSW 19 12428832 missense probably damaging 0.98
R0276:Pfpl UTSW 19 12429237 missense probably damaging 1.00
R0433:Pfpl UTSW 19 12429475 missense probably damaging 1.00
R1510:Pfpl UTSW 19 12429696 missense probably benign 0.31
R1759:Pfpl UTSW 19 12429860 missense probably damaging 1.00
R2009:Pfpl UTSW 19 12429955 missense possibly damaging 0.95
R2063:Pfpl UTSW 19 12429873 missense probably damaging 1.00
R2201:Pfpl UTSW 19 12430479 missense probably benign 0.01
R2656:Pfpl UTSW 19 12430236 missense probably benign
R2969:Pfpl UTSW 19 12429543 missense probably benign 0.00
R3003:Pfpl UTSW 19 12430326 missense possibly damaging 0.90
R3428:Pfpl UTSW 19 12430313 missense probably benign 0.37
R3904:Pfpl UTSW 19 12430437 missense probably benign 0.00
R4049:Pfpl UTSW 19 12429689 missense probably damaging 1.00
R4717:Pfpl UTSW 19 12429254 missense probably benign 0.07
R5343:Pfpl UTSW 19 12428688 missense probably damaging 0.99
R5804:Pfpl UTSW 19 12429663 missense probably benign 0.00
R6032:Pfpl UTSW 19 12429383 missense probably damaging 0.99
R6032:Pfpl UTSW 19 12429383 missense probably damaging 0.99
R6047:Pfpl UTSW 19 12429233 missense probably damaging 1.00
R6106:Pfpl UTSW 19 12429461 missense probably damaging 0.99
R6657:Pfpl UTSW 19 12429926 missense probably benign 0.36
R7467:Pfpl UTSW 19 12428514 missense probably damaging 1.00
R7720:Pfpl UTSW 19 12429174 missense probably benign 0.02
R8024:Pfpl UTSW 19 12430206 missense possibly damaging 0.94
R8370:Pfpl UTSW 19 12429911 missense probably damaging 0.99
Z1176:Pfpl UTSW 19 12429941 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTACACGAGCATCTCTGGCTCCTG -3'
(R):5'- AGCATTCCGACAATGGCTGAGAAC -3'

Sequencing Primer
(F):5'- AGAGTCCCATATCCTGGGTTAAG -3'
(R):5'- AAAAACCTTCTTTCGGTTGCG -3'
Posted On2014-01-05