Mutagenetix > Incidental Mutation

Incidental Mutation 'R1004:Ric1'

98019

Institutional Source

Beutler Lab

Gene Symbol

Ric1

Ensembl Gene

ENSMUSG00000038658

Gene Name

RAB6A GEF complex partner 1

Synonyms

C030046E11Rik, C130057E09Rik

MMRRC Submission

039114-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.534) question?

Stock #

R1004 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29522282-29606829 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29602357 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1233 (N1233S)

Ref Sequence

ENSEMBL: ENSMUSP00000043437 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043610]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000043610
AA Change: N1233S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: N1233S

Domain	Start	End	E-Value	Type
Blast:WD40	242	278	5e-7	BLAST
SCOP:d1gxra_	254	379	2e-4	SMART
Blast:WD40	285	334	3e-6	BLAST
Blast:WD40	482	520	5e-6	BLAST
low complexity region	642	653	N/A	INTRINSIC
Pfam:RIC1	732	991	1.9e-86	PFAM
low complexity region	1120	1132	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160452

SMART Domains

Protein: ENSMUSP00000125299
Gene: ENSMUSG00000038658

Domain	Start	End	E-Value	Type
Pfam:RIC1	8	163	1.4e-60	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000161330
AA Change: N254S

SMART Domains

Protein: ENSMUSP00000125709
Gene: ENSMUSG00000038658
AA Change: N254S

Domain	Start	End	E-Value	Type
low complexity region	7	28	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161536

Predicted Effect

unknown
Transcript: ENSMUST00000162492
AA Change: N1124S

SMART Domains

Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: N1124S

Domain	Start	End	E-Value	Type
Blast:WD40	171	207	4e-7	BLAST
SCOP:d1gxra_	183	308	2e-4	SMART
Blast:WD40	214	263	2e-6	BLAST
low complexity region	534	545	N/A	INTRINSIC
Pfam:RIC1	624	883	1.6e-86	PFAM
low complexity region	1012	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.0579

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (41/41)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,151,954	I423T	possibly damaging	Het
Agbl3	A	T	6: 34,803,451	E453V	probably damaging	Het
Agxt	A	G	1: 93,135,699	M108V	possibly damaging	Het
Akap13	T	C	7: 75,687,286	I831T	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arid1a	A	G	4: 133,687,275	M1215T	unknown	Het
Cd163	G	T	6: 124,325,347	D957Y	probably damaging	Het
Ces2e	A	G	8: 104,929,738	D200G	probably damaging	Het
Cfap54	T	C	10: 93,066,696		probably benign	Het
Col11a1	A	G	3: 114,095,022		probably benign	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Dpp4	T	A	2: 62,332,640	Q754L	probably benign	Het
Ece1	A	G	4: 137,926,239	T100A	probably benign	Het
Gabbr2	C	T	4: 46,677,544	V779M	possibly damaging	Het
Gatm	C	T	2: 122,609,660		probably benign	Het
Gm20767	T	A	13: 120,155,022	D132E	probably benign	Het
Gpc2	A	G	5: 138,278,225	L213P	probably damaging	Het
Hook1	A	C	4: 96,022,287	N713H	probably benign	Het
Kdm5b	T	A	1: 134,588,904	I178K	possibly damaging	Het
Mettl9	G	A	7: 121,076,237	V287I	probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mycbp2	G	A	14: 103,140,917	T3774I	probably benign	Het
Nupl1	C	A	14: 60,247,481		probably benign	Het
Nxf1	A	T	19: 8,764,317	T119S	probably benign	Het
Oaz3	T	A	3: 94,435,043	H102L	probably damaging	Het
Olfr971	T	C	9: 39,839,980	F182S	probably benign	Het
Pfpl	A	T	19: 12,430,425	Q680L	probably benign	Het
Poli	T	A	18: 70,525,438	Q75L	probably benign	Het
Ppp2r3a	C	T	9: 101,198,630		probably null	Het
Prr30	A	G	14: 101,199,093	L11P	probably damaging	Het
Ptchd4	A	T	17: 42,377,602	Y345F	probably benign	Het
Serpinb9f	TA	"TTTNA,T"	13: 33,334,242		probably benign	Het
Sh3bgrl2	C	T	9: 83,577,631		probably benign	Het
Skp1a	G	C	11: 52,237,380		probably benign	Het
Slc12a9	T	C	5: 137,322,524	K528R	probably damaging	Het
Slc22a6	A	G	19: 8,618,399	N35S	probably damaging	Het
Xrcc5	A	G	1: 72,383,778		probably benign	Het
Zfp235	T	A	7: 24,140,744	L266Q	probably damaging	Het
Zfp600	T	A	4: 146,196,533		probably benign	Het

Other mutations in Ric1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Ric1	APN	19	29595362	missense	probably damaging	1.00
IGL00902:Ric1	APN	19	29567231	missense	probably benign	0.05
IGL01405:Ric1	APN	19	29567370	splice site	probably benign
IGL01629:Ric1	APN	19	29603981	missense	probably benign	0.02
IGL01688:Ric1	APN	19	29577614	missense	probably benign	0.00
IGL01966:Ric1	APN	19	29595563	missense	probably benign	0.33
IGL02123:Ric1	APN	19	29594800	missense	probably benign
IGL02590:Ric1	APN	19	29567481	splice site	probably benign
IGL02655:Ric1	APN	19	29595451	missense	probably damaging	1.00
IGL02699:Ric1	APN	19	29522557	missense	possibly damaging	0.51
IGL02718:Ric1	APN	19	29533240	missense	probably damaging	1.00
IGL03026:Ric1	APN	19	29599833	missense	probably benign	0.02
IGL03142:Ric1	APN	19	29600980	missense	possibly damaging	0.89
R0109:Ric1	UTSW	19	29586677	synonymous	silent
R0336:Ric1	UTSW	19	29587793	missense	probably damaging	0.96
R0362:Ric1	UTSW	19	29601011	critical splice donor site	probably null
R0676:Ric1	UTSW	19	29577647	missense	probably benign
R0734:Ric1	UTSW	19	29594818	missense	possibly damaging	0.66
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1216:Ric1	UTSW	19	29577735	missense	probably benign	0.00
R1493:Ric1	UTSW	19	29579849	missense	probably benign
R1848:Ric1	UTSW	19	29600813	splice site	probably null
R1872:Ric1	UTSW	19	29602668	missense	probably benign	0.32
R1942:Ric1	UTSW	19	29601016	splice site	probably benign
R2143:Ric1	UTSW	19	29533252	missense	probably damaging	1.00
R2143:Ric1	UTSW	19	29533253	missense	probably damaging	0.96
R2679:Ric1	UTSW	19	29604030	missense	probably benign
R2878:Ric1	UTSW	19	29602330	missense	possibly damaging	0.77
R2970:Ric1	UTSW	19	29577718	missense	probably benign	0.15
R3420:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3421:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3940:Ric1	UTSW	19	29570762	missense	probably damaging	1.00
R4004:Ric1	UTSW	19	29579801	missense	probably benign	0.44
R4225:Ric1	UTSW	19	29602731	missense	possibly damaging	0.89
R4280:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4283:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4516:Ric1	UTSW	19	29570765	missense	probably benign	0.17
R4702:Ric1	UTSW	19	29598017	missense	possibly damaging	0.85
R4824:Ric1	UTSW	19	29585842	missense	probably damaging	1.00
R4835:Ric1	UTSW	19	29595536	missense	possibly damaging	0.80
R5860:Ric1	UTSW	19	29599845	missense	possibly damaging	0.91
R5883:Ric1	UTSW	19	29595989	missense	probably damaging	1.00
R5965:Ric1	UTSW	19	29570771	missense	probably damaging	0.99
R6141:Ric1	UTSW	19	29595442	missense	probably damaging	1.00
R6236:Ric1	UTSW	19	29595426	missense	possibly damaging	0.91
R6271:Ric1	UTSW	19	29567365	splice site	probably null
R6345:Ric1	UTSW	19	29604085	missense	probably benign	0.09
R6371:Ric1	UTSW	19	29562026	missense	probably benign	0.35
R6547:Ric1	UTSW	19	29594826	missense	probably damaging	1.00
R6924:Ric1	UTSW	19	29569388	missense	probably damaging	0.98
R6969:Ric1	UTSW	19	29585782	missense	probably damaging	1.00
R6970:Ric1	UTSW	19	29587772	missense	probably damaging	1.00
R6993:Ric1	UTSW	19	29586613	missense	probably damaging	1.00
R7296:Ric1	UTSW	19	29584578	critical splice donor site	probably null
R7434:Ric1	UTSW	19	29574780	missense	probably damaging	1.00
R7619:Ric1	UTSW	19	29579775	missense	probably benign	0.32
R7850:Ric1	UTSW	19	29594893	missense	probably benign
R7941:Ric1	UTSW	19	29533259	missense	probably damaging	1.00
R8115:Ric1	UTSW	19	29586573	missense	probably damaging	1.00
R8117:Ric1	UTSW	19	29574791	missense	probably benign	0.08
R8477:Ric1	UTSW	19	29597783	missense	probably damaging	1.00
R9023:Ric1	UTSW	19	29570743	splice site	probably benign
R9044:Ric1	UTSW	19	29599894	missense	probably damaging	1.00
R9727:Ric1	UTSW	19	29597858	missense	probably damaging	1.00
R9733:Ric1	UTSW	19	29602630	missense	possibly damaging	0.94
X0064:Ric1	UTSW	19	29587802	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTGTGAAGGCTCCCAACTGC -3'
(R):5'- CTCTGAGAATCAGGCCGATGACAAC -3'

Sequencing Primer
(F):5'- TGGCTATTTTAGCAGTAGATTGAATG -3'
(R):5'- GCCTCCATGAAAATGTGCAG -3'

Posted On

2014-01-05