Incidental Mutation 'R1130:Hist1h1t'
ID98048
Institutional Source Beutler Lab
Gene Symbol Hist1h1t
Ensembl Gene ENSMUSG00000036211
Gene Namehistone cluster 1, H1t
SynonymsH1ft
MMRRC Submission 039203-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1130 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23695814-23696725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23696324 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 153 (K153N)
Ref Sequence ENSEMBL: ENSMUSP00000037304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018246] [ENSMUST00000041052] [ENSMUST00000102967]
Predicted Effect probably benign
Transcript: ENSMUST00000018246
SMART Domains Protein: ENSMUSP00000018246
Gene: ENSMUSG00000018102

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000041052
AA Change: K153N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037304
Gene: ENSMUSG00000036211
AA Change: K153N

DomainStartEndE-ValueType
H15 37 102 5.15e-21 SMART
low complexity region 111 135 N/A INTRINSIC
low complexity region 142 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102967
SMART Domains Protein: ENSMUSP00000100032
Gene: ENSMUSG00000060678

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Meta Mutation Damage Score 0.1509 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice develop normally and exhibit normal testicular morphology, spermatogenesis and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C T 15: 82,059,360 H58Y probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Armc2 T C 10: 42,011,834 D51G possibly damaging Het
Aspm A T 1: 139,477,834 K1486N possibly damaging Het
Aurka A T 2: 172,357,258 probably null Het
Cfap45 T C 1: 172,545,697 Y534H probably damaging Het
Cldn20 T C 17: 3,532,968 Y139H probably damaging Het
Defb19 C A 2: 152,576,189 E76* probably null Het
Fcho2 A T 13: 98,748,289 D423E probably damaging Het
Frem1 T G 4: 82,916,628 probably null Het
Gaa C T 11: 119,274,683 T333M probably damaging Het
Gm9945 T A 11: 53,480,518 probably benign Het
Gml2 G A 15: 74,821,346 C66Y probably damaging Het
Kcnh2 G A 5: 24,331,825 R254* probably null Het
Megf10 T C 18: 57,262,006 V480A probably benign Het
Nrde2 A T 12: 100,125,670 M1152K probably damaging Het
Ociad1 T C 5: 73,294,332 S15P probably benign Het
Ptprj A G 2: 90,453,421 V803A probably damaging Het
Skint7 T C 4: 111,984,158 I265T probably benign Het
Srsf2 A G 11: 116,852,183 probably benign Het
Tac2 A G 10: 127,729,502 N108D possibly damaging Het
Tmem5 T C 10: 122,095,942 I109V possibly damaging Het
Other mutations in Hist1h1t
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Hist1h1t APN 13 23696049 missense probably damaging 0.98
FR4304:Hist1h1t UTSW 13 23695920 unclassified probably benign
FR4342:Hist1h1t UTSW 13 23695913 unclassified probably benign
FR4548:Hist1h1t UTSW 13 23695920 unclassified probably benign
R0167:Hist1h1t UTSW 13 23695903 missense probably benign 0.02
R0238:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0238:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0564:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0726:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0827:Hist1h1t UTSW 13 23696221 missense probably benign 0.01
R0972:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1128:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1129:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R5652:Hist1h1t UTSW 13 23696236 missense probably benign 0.01
R5827:Hist1h1t UTSW 13 23696202 missense possibly damaging 0.91
R6538:Hist1h1t UTSW 13 23695921 missense probably benign 0.06
R7729:Hist1h1t UTSW 13 23696472 missense possibly damaging 0.93
R7774:Hist1h1t UTSW 13 23696200 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CGTGGAGAAGAACAACAGCCGTATC -3'
(R):5'- GTGGAAGCTCCTACTGGCGTTATC -3'

Sequencing Primer
(F):5'- GTATCAAGCTGGCCCTCAAGAG -3'
(R):5'- CTAGGGTTTCAACGACAGGTC -3'
Posted On2014-01-05