Incidental Mutation 'R1130:Gml2'
ID98050
Institutional Source Beutler Lab
Gene Symbol Gml2
Ensembl Gene ENSMUSG00000068600
Gene Nameglycosylphosphatidylinositol anchored molecule like 2
SynonymsHemt1, hematopoietic cell-specific transcript, HemT, 1700057K19Rik
MMRRC Submission 039203-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R1130 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location74819071-74834871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74821346 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 66 (C66Y)
Ref Sequence ENSEMBL: ENSMUSP00000094130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096399] [ENSMUST00000096400] [ENSMUST00000164026] [ENSMUST00000185253] [ENSMUST00000188180]
Predicted Effect probably damaging
Transcript: ENSMUST00000096399
AA Change: C66Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000094130
Gene: ENSMUSG00000068600
AA Change: C66Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.06e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096400
SMART Domains Protein: ENSMUSP00000094131
Gene: ENSMUSG00000068349

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.3e-5 SMART
low complexity region 162 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164026
SMART Domains Protein: ENSMUSP00000128174
Gene: ENSMUSG00000068349

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.3e-5 SMART
low complexity region 162 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185253
SMART Domains Protein: ENSMUSP00000140245
Gene: ENSMUSG00000068349

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:UPAR_LY6 49 104 3.8e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186752
Predicted Effect probably damaging
Transcript: ENSMUST00000188180
AA Change: C66Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141185
Gene: ENSMUSG00000068600
AA Change: C66Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:LU 47 80 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188458
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C T 15: 82,059,360 H58Y probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Armc2 T C 10: 42,011,834 D51G possibly damaging Het
Aspm A T 1: 139,477,834 K1486N possibly damaging Het
Aurka A T 2: 172,357,258 probably null Het
Cfap45 T C 1: 172,545,697 Y534H probably damaging Het
Cldn20 T C 17: 3,532,968 Y139H probably damaging Het
Defb19 C A 2: 152,576,189 E76* probably null Het
Fcho2 A T 13: 98,748,289 D423E probably damaging Het
Frem1 T G 4: 82,916,628 probably null Het
Gaa C T 11: 119,274,683 T333M probably damaging Het
Gm9945 T A 11: 53,480,518 probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Kcnh2 G A 5: 24,331,825 R254* probably null Het
Megf10 T C 18: 57,262,006 V480A probably benign Het
Nrde2 A T 12: 100,125,670 M1152K probably damaging Het
Ociad1 T C 5: 73,294,332 S15P probably benign Het
Ptprj A G 2: 90,453,421 V803A probably damaging Het
Skint7 T C 4: 111,984,158 I265T probably benign Het
Srsf2 A G 11: 116,852,183 probably benign Het
Tac2 A G 10: 127,729,502 N108D possibly damaging Het
Tmem5 T C 10: 122,095,942 I109V possibly damaging Het
Other mutations in Gml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Gml2 APN 15 74824221 nonsense probably null
R0031:Gml2 UTSW 15 74824276 missense probably benign 0.12
R0608:Gml2 UTSW 15 74821386 critical splice donor site probably null
R1087:Gml2 UTSW 15 74824097 missense possibly damaging 0.73
R1503:Gml2 UTSW 15 74821352 nonsense probably null
R4408:Gml2 UTSW 15 74824339 intron probably benign
R6802:Gml2 UTSW 15 74824246 missense probably damaging 1.00
R7351:Gml2 UTSW 15 74821376 missense possibly damaging 0.57
R7833:Gml2 UTSW 15 74821368 nonsense probably null
R7910:Gml2 UTSW 15 74820530 critical splice acceptor site probably null
R8513:Gml2 UTSW 15 74824155 missense probably damaging 1.00
R8695:Gml2 UTSW 15 74824240 missense probably benign 0.05
X0066:Gml2 UTSW 15 74824050 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGGGGAGTCACCATTCCACAGAC -3'
(R):5'- GCCATTAGGCACACTACTCAAGCAG -3'

Sequencing Primer
(F):5'- GCCTTAGACTATGCCAGAATGTG -3'
(R):5'- TACTCAAGCAGTGGGCTGAAC -3'
Posted On2014-01-05