Mutagenetix > Incidental Mutations

Incidental Mutation 'R1101:Iqca'

98058

Institutional Source

Beutler Lab

Gene Symbol

Iqca

Ensembl Gene

ENSMUSG00000026301

Gene Name

IQ motif containing with AAA domain

Synonyms

MMRRC Submission

039174-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1101 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90042132-90153401 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 90142731 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 133 (G133V)

Ref Sequence

ENSEMBL: ENSMUSP00000108717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113094] [ENSMUST00000113094] [ENSMUST00000212394] [ENSMUST00000212394]

AlphaFold

Q9CUL5

Predicted Effect

probably null
Transcript: ENSMUST00000113094
AA Change: G133V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108717
Gene: ENSMUSG00000026301
AA Change: G133V

Domain	Start	End	E-Value	Type
IQ	205	227	6.97e0	SMART
coiled coil region	340	380	N/A	INTRINSIC
coiled coil region	425	450	N/A	INTRINSIC
low complexity region	464	487	N/A	INTRINSIC
AAA	567	706	1.08e-3	SMART
low complexity region	812	829	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000113094
AA Change: G133V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108717
Gene: ENSMUSG00000026301
AA Change: G133V

Domain	Start	End	E-Value	Type
IQ	205	227	6.97e0	SMART
coiled coil region	340	380	N/A	INTRINSIC
coiled coil region	425	450	N/A	INTRINSIC
low complexity region	464	487	N/A	INTRINSIC
AAA	567	706	1.08e-3	SMART
low complexity region	812	829	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186522

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211999

Predicted Effect

probably null
Transcript: ENSMUST00000212394
AA Change: G133V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably null
Transcript: ENSMUST00000212394
AA Change: G133V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

Meta Mutation Damage Score

0.1927

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATPases Associated with diverse cellular Activities (AAA) superfamily. Members of this superfamily, found in all organisms, participate in a large number of cellular processes and contain the ATPase module consisting of an alpha-beta-alpha core domain and the Walker A and B motifs of the P-loop NTPases. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2610021A01Rik	C	A	7: 41,627,359	H829N	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abi3bp	G	T	16: 56,606,158	R512L	probably damaging	Het
Acot2	T	G	12: 83,992,850	S378A	probably benign	Het
Akap9	T	C	5: 4,046,205	I2360T	probably benign	Het
Bank1	T	C	3: 136,283,864	D155G	probably benign	Het
Bsn	A	G	9: 108,116,411	V714A	probably damaging	Het
Cdh15	G	A	8: 122,860,846	V170I	possibly damaging	Het
Clcn2	G	A	16: 20,703,595	T787I	probably damaging	Het
Dapk1	A	G	13: 60,716,785	H131R	probably damaging	Het
Dct	T	G	14: 118,036,622	D291A	probably damaging	Het
Dhx37	A	G	5: 125,415,152	Y1128H	probably damaging	Het
Dip2c	A	T	13: 9,634,744	I1174F	probably damaging	Het
Eif3l	A	G	15: 79,075,267	Y3C	probably damaging	Het
Enpp5	A	G	17: 44,081,367	N229S	possibly damaging	Het
Fam83b	A	T	9: 76,545,670	H38Q	possibly damaging	Het
Fcamr	T	A	1: 130,814,486		probably null	Het
Hdac2	G	A	10: 36,991,809	V184I	probably damaging	Het
Igf2bp2	A	T	16: 22,162,950	L5Q	probably damaging	Het
Ireb2	T	A	9: 54,909,702	H951Q	probably benign	Het
Lman1	T	A	18: 65,987,898	M418L	probably benign	Het
Lrrfip2	C	T	9: 111,190,225	R275W	probably damaging	Het
Mast3	T	A	8: 70,786,663	I424F	probably damaging	Het
Mep1a	T	C	17: 43,491,693	D147G	probably benign	Het
Mtr	C	A	13: 12,189,525	E1128D	possibly damaging	Het
Ogfod1	C	A	8: 94,064,304	S534R	probably benign	Het
Olfr1212	A	T	2: 88,958,984	I173F	possibly damaging	Het
Olfr1290	T	C	2: 111,489,442	T239A	probably damaging	Het
Olfr173	A	G	16: 58,797,252	V198A	probably benign	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pcdh18	T	A	3: 49,753,379	D882V	probably damaging	Het
Pik3cg	C	T	12: 32,195,646	G868S	probably null	Het
Plppr5	T	G	3: 117,662,523	M231R	probably damaging	Het
Polr2a	T	C	11: 69,748,071	T46A	probably benign	Het
Ppp4r3a	C	A	12: 101,051,571	R440L	probably damaging	Het
Serpinb9e	A	T	13: 33,260,088	T364S	probably benign	Het
Sirt3	A	G	7: 140,869,628	V135A	possibly damaging	Het
Supt16	T	C	14: 52,171,439	N826S	probably null	Het
Tbr1	T	C	2: 61,804,739	I11T	probably benign	Het
Trim72	A	G	7: 128,010,247	E407G	possibly damaging	Het
Vps72	C	A	3: 95,119,176	T144K	probably damaging	Het

Other mutations in Iqca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Iqca	APN	1	90045657	missense	probably benign	0.10
IGL01367:Iqca	APN	1	90070628	splice site	probably benign
IGL01545:Iqca	APN	1	90045642	missense	probably benign
IGL01797:Iqca	APN	1	90144819	critical splice donor site	probably null
IGL02098:Iqca	APN	1	90047941	missense	probably damaging	0.96
IGL02194:Iqca	APN	1	90045663	missense	probably benign	0.16
IGL03230:Iqca	APN	1	90145002	missense	probably damaging	1.00
IGL03259:Iqca	APN	1	90052434	missense	probably damaging	1.00
IGL03372:Iqca	APN	1	90144969	missense	possibly damaging	0.80
R0383:Iqca	UTSW	1	90142707	missense	probably damaging	1.00
R0610:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0685:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0798:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0799:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0800:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0801:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0825:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0826:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0827:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0862:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0863:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0864:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0960:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0961:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0962:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0963:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1344:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1523:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1646:Iqca	UTSW	1	90140038	missense	probably damaging	0.98
R1682:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1742:Iqca	UTSW	1	90098051	missense	probably benign	0.01
R1774:Iqca	UTSW	1	90080903	missense	probably benign	0.02
R1775:Iqca	UTSW	1	90081416	missense	probably damaging	1.00
R2011:Iqca	UTSW	1	90045626	missense	probably benign	0.00
R2065:Iqca	UTSW	1	90130231	missense	probably benign	0.01
R2156:Iqca	UTSW	1	90089516	missense	possibly damaging	0.78
R2186:Iqca	UTSW	1	90081344	missense	probably benign	0.06
R3872:Iqca	UTSW	1	90089481	missense	probably damaging	1.00
R4308:Iqca	UTSW	1	90144897	missense	probably damaging	1.00
R4578:Iqca	UTSW	1	90073750	missense	probably damaging	0.98
R4737:Iqca	UTSW	1	90077822	missense	probably damaging	0.99
R4867:Iqca	UTSW	1	90089504	missense	probably benign	0.00
R4884:Iqca	UTSW	1	90140037	missense	probably benign	0.10
R4887:Iqca	UTSW	1	90045701	missense	probably damaging	1.00
R5352:Iqca	UTSW	1	90130196	missense	probably benign	0.00
R5733:Iqca	UTSW	1	90070535	missense	probably damaging	0.97
R5838:Iqca	UTSW	1	90144945	missense	probably benign	0.22
R5951:Iqca	UTSW	1	90140097	splice site	probably null
R5957:Iqca	UTSW	1	90080948	missense	probably damaging	1.00
R6696:Iqca	UTSW	1	90130200	missense	probably benign
R7240:Iqca	UTSW	1	90070550	missense	possibly damaging	0.88
R7769:Iqca	UTSW	1	90077810	missense	possibly damaging	0.82
R7841:Iqca	UTSW	1	90059615	missense
R8069:Iqca	UTSW	1	90045744	missense	probably damaging	0.96
R8103:Iqca	UTSW	1	90059608	missense
R8932:Iqca	UTSW	1	90140028	missense	probably damaging	1.00
R8963:Iqca	UTSW	1	90139927	missense	probably benign	0.02
R9055:Iqca	UTSW	1	90070613	missense	probably benign	0.02
R9168:Iqca	UTSW	1	90138215	missense	probably damaging	0.98
R9342:Iqca	UTSW	1	90144966	missense	probably damaging	0.99
Z1176:Iqca	UTSW	1	90045725	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- AGAGCCCAAACGTTCCTTAATCCTG -3'
(R):5'- TCTGAACTGACCTCCCAAGCTGAC -3'

Sequencing Primer
(F):5'- CTAGACCTCATAGAGCAAGCGTG -3'
(R):5'- ccacaaacacccttacccac -3'

Posted On

2014-01-05