Mutagenetix > Incidental Mutations

Incidental Mutation 'R1101:Tbr1'

98063

Institutional Source

Beutler Lab

Gene Symbol

Tbr1

Ensembl Gene

ENSMUSG00000035033

Gene Name

T-box brain gene 1

Synonyms

MMRRC Submission

039174-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1101 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

61802930-61814114 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61804739 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 11 (I11T)

Ref Sequence

ENSEMBL: ENSMUSP00000046787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028278] [ENSMUST00000048934] [ENSMUST00000102737]

Predicted Effect

probably benign
Transcript: ENSMUST00000028278

SMART Domains

Protein: ENSMUSP00000028278
Gene: ENSMUSG00000026914

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
JAB_MPN	30	165	3.71e-49	SMART
Pfam:MitMem_reg	173	307	9e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000048934
AA Change: I11T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000046787
Gene: ENSMUSG00000035033
AA Change: I11T

Domain	Start	End	E-Value	Type
low complexity region	108	122	N/A	INTRINSIC
TBOX	203	398	1.6e-125	SMART
Pfam:T-box_assoc	418	679	9.6e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102737

SMART Domains

Protein: ENSMUSP00000099798
Gene: ENSMUSG00000035033

Domain	Start	End	E-Value	Type
TBOX	1	135	5.05e-41	SMART
low complexity region	184	193	N/A	INTRINSIC
low complexity region	306	315	N/A	INTRINSIC
low complexity region	319	329	N/A	INTRINSIC
low complexity region	355	365	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131538

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136867

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154627

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of numerous developmental processes. In mouse, the ortholog of this gene is expressed in the cerebral cortex, hippocampus, amygdala and olfactory bulb and is thought to play an important role in neuronal migration and axonal projection. In mouse, the C-terminal region of this protein was found to be necessary and sufficient for association with the guanylate kinase domain of calcium/calmodulin-dependent serine protein kinase. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted null allele fail to feed and die on the second postnatal day displaying disrupted forebrain morphology and a hypoplastic olfactory bulb that lacks normal mitral and tufted cells and shows a striking reduction in mature olfactory bulb projection neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2610021A01Rik	C	A	7: 41,627,359	H829N	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abi3bp	G	T	16: 56,606,158	R512L	probably damaging	Het
Acot2	T	G	12: 83,992,850	S378A	probably benign	Het
Akap9	T	C	5: 4,046,205	I2360T	probably benign	Het
Bank1	T	C	3: 136,283,864	D155G	probably benign	Het
Bsn	A	G	9: 108,116,411	V714A	probably damaging	Het
Cdh15	G	A	8: 122,860,846	V170I	possibly damaging	Het
Clcn2	G	A	16: 20,703,595	T787I	probably damaging	Het
Dapk1	A	G	13: 60,716,785	H131R	probably damaging	Het
Dct	T	G	14: 118,036,622	D291A	probably damaging	Het
Dhx37	A	G	5: 125,415,152	Y1128H	probably damaging	Het
Dip2c	A	T	13: 9,634,744	I1174F	probably damaging	Het
Eif3l	A	G	15: 79,075,267	Y3C	probably damaging	Het
Enpp5	A	G	17: 44,081,367	N229S	possibly damaging	Het
Fam83b	A	T	9: 76,545,670	H38Q	possibly damaging	Het
Fcamr	T	A	1: 130,814,486		probably null	Het
Hdac2	G	A	10: 36,991,809	V184I	probably damaging	Het
Igf2bp2	A	T	16: 22,162,950	L5Q	probably damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Ireb2	T	A	9: 54,909,702	H951Q	probably benign	Het
Lman1	T	A	18: 65,987,898	M418L	probably benign	Het
Lrrfip2	C	T	9: 111,190,225	R275W	probably damaging	Het
Mast3	T	A	8: 70,786,663	I424F	probably damaging	Het
Mep1a	T	C	17: 43,491,693	D147G	probably benign	Het
Mtr	C	A	13: 12,189,525	E1128D	possibly damaging	Het
Ogfod1	C	A	8: 94,064,304	S534R	probably benign	Het
Olfr1212	A	T	2: 88,958,984	I173F	possibly damaging	Het
Olfr1290	T	C	2: 111,489,442	T239A	probably damaging	Het
Olfr173	A	G	16: 58,797,252	V198A	probably benign	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pcdh18	T	A	3: 49,753,379	D882V	probably damaging	Het
Pik3cg	C	T	12: 32,195,646	G868S	probably null	Het
Plppr5	T	G	3: 117,662,523	M231R	probably damaging	Het
Polr2a	T	C	11: 69,748,071	T46A	probably benign	Het
Ppp4r3a	C	A	12: 101,051,571	R440L	probably damaging	Het
Serpinb9e	A	T	13: 33,260,088	T364S	probably benign	Het
Sirt3	A	G	7: 140,869,628	V135A	possibly damaging	Het
Supt16	T	C	14: 52,171,439	N826S	probably null	Het
Trim72	A	G	7: 128,010,247	E407G	possibly damaging	Het
Vps72	C	A	3: 95,119,176	T144K	probably damaging	Het

Other mutations in Tbr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Tbr1	APN	2	61805281	missense	probably benign	0.14
IGL01309:Tbr1	APN	2	61806067	missense	possibly damaging	0.92
IGL02161:Tbr1	APN	2	61805239	nonsense	probably null
IGL02256:Tbr1	APN	2	61804874	missense	probably damaging	0.99
IGL02336:Tbr1	APN	2	61804992	missense	possibly damaging	0.93
IGL02526:Tbr1	APN	2	61811698	missense	probably benign	0.00
FR4340:Tbr1	UTSW	2	61806347	intron	probably benign
R0594:Tbr1	UTSW	2	61811620	missense	possibly damaging	0.49
R0847:Tbr1	UTSW	2	61805029	missense	probably benign	0.00
R1247:Tbr1	UTSW	2	61811618	missense	possibly damaging	0.78
R1944:Tbr1	UTSW	2	61812256	missense	probably damaging	1.00
R3080:Tbr1	UTSW	2	61807291	nonsense	probably null
R4110:Tbr1	UTSW	2	61811732	missense	probably benign	0.18
R4111:Tbr1	UTSW	2	61811732	missense	probably benign	0.18
R4440:Tbr1	UTSW	2	61804838	missense	possibly damaging	0.92
R4790:Tbr1	UTSW	2	61811588	missense	probably benign	0.04
R4979:Tbr1	UTSW	2	61805249	splice site	probably null
R5054:Tbr1	UTSW	2	61806002	missense	possibly damaging	0.83
R5283:Tbr1	UTSW	2	61804900	missense	probably benign	0.00
R5545:Tbr1	UTSW	2	61807376	missense	possibly damaging	0.93
R6178:Tbr1	UTSW	2	61804815	missense	possibly damaging	0.91
R6290:Tbr1	UTSW	2	61805050	missense	probably benign
R6389:Tbr1	UTSW	2	61806287	start gained	probably benign
R6637:Tbr1	UTSW	2	61811630	missense	probably benign	0.17
R6983:Tbr1	UTSW	2	61811735	missense	probably damaging	1.00
R7021:Tbr1	UTSW	2	61807344	missense	probably benign	0.18
R7112:Tbr1	UTSW	2	61811816	missense	probably benign	0.02
R7254:Tbr1	UTSW	2	61806042	missense	probably damaging	1.00
R7291:Tbr1	UTSW	2	61812256	missense	probably damaging	1.00
R7438:Tbr1	UTSW	2	61804817	missense	possibly damaging	0.92
R8253:Tbr1	UTSW	2	61805241	missense	probably benign	0.16
Z1176:Tbr1	UTSW	2	61812147	missense	probably benign
Z1177:Tbr1	UTSW	2	61812231	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATCGGCTGCATAAGCAGCAAG -3'
(R):5'- AACTGTGACGAAGCTCAGAGACCC -3'

Sequencing Primer
(F):5'- GCAAGATCAAAAGTGAGCCTTTTC -3'
(R):5'- CCTTGGAGTCAGGAAAATTGTC -3'

Posted On

2014-01-05