Mutagenetix > Incidental Mutations

Incidental Mutation 'R1101:Vps72'

98069

Institutional Source

Beutler Lab

Gene Symbol

Vps72

Ensembl Gene

ENSMUSG00000008958

Gene Name

vacuolar protein sorting 72

Synonyms

YL-1, Tcfl1

MMRRC Submission

039174-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1101 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95111022-95123051 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 95119176 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 144 (T144K)

Ref Sequence

ENSEMBL: ENSMUSP00000009102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009102]

Predicted Effect

probably damaging
Transcript: ENSMUST00000009102
AA Change: T144K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000009102
Gene: ENSMUSG00000008958
AA Change: T144K

Domain	Start	End	E-Value	Type
Pfam:YL1	5	216	5.1e-58	PFAM
low complexity region	247	264	N/A	INTRINSIC
YL1_C	294	323	5.99e-9	SMART
low complexity region	335	358	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125548

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136076

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139296

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152333

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a shared subunit of two multi-component complexes, the histone acetyltransferase complex TRRAP/TIP60 as well as the chromatin remodeling SRCAP-containing complex. The TRRAP/TIP60 complex acetylates nucleosomal histones important for transcriptional regulation, double strand DNA break repair and apoptosis. The SRCAP-containing complex catalyzes the exchange of histone H2A with the histone variant Htz1 (H2AFZ) into nucleosomes. This protein may be responsible for binding H2AFZ, which has a role in chromosome segregation. This protein may also have a role in regulating long-term hematopoietic stem cell activity. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2610021A01Rik	C	A	7: 41,627,359	H829N	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abi3bp	G	T	16: 56,606,158	R512L	probably damaging	Het
Acot2	T	G	12: 83,992,850	S378A	probably benign	Het
Akap9	T	C	5: 4,046,205	I2360T	probably benign	Het
Bank1	T	C	3: 136,283,864	D155G	probably benign	Het
Bsn	A	G	9: 108,116,411	V714A	probably damaging	Het
Cdh15	G	A	8: 122,860,846	V170I	possibly damaging	Het
Clcn2	G	A	16: 20,703,595	T787I	probably damaging	Het
Dapk1	A	G	13: 60,716,785	H131R	probably damaging	Het
Dct	T	G	14: 118,036,622	D291A	probably damaging	Het
Dhx37	A	G	5: 125,415,152	Y1128H	probably damaging	Het
Dip2c	A	T	13: 9,634,744	I1174F	probably damaging	Het
Eif3l	A	G	15: 79,075,267	Y3C	probably damaging	Het
Enpp5	A	G	17: 44,081,367	N229S	possibly damaging	Het
Fam83b	A	T	9: 76,545,670	H38Q	possibly damaging	Het
Fcamr	T	A	1: 130,814,486		probably null	Het
Hdac2	G	A	10: 36,991,809	V184I	probably damaging	Het
Igf2bp2	A	T	16: 22,162,950	L5Q	probably damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Ireb2	T	A	9: 54,909,702	H951Q	probably benign	Het
Lman1	T	A	18: 65,987,898	M418L	probably benign	Het
Lrrfip2	C	T	9: 111,190,225	R275W	probably damaging	Het
Mast3	T	A	8: 70,786,663	I424F	probably damaging	Het
Mep1a	T	C	17: 43,491,693	D147G	probably benign	Het
Mtr	C	A	13: 12,189,525	E1128D	possibly damaging	Het
Ogfod1	C	A	8: 94,064,304	S534R	probably benign	Het
Olfr1212	A	T	2: 88,958,984	I173F	possibly damaging	Het
Olfr1290	T	C	2: 111,489,442	T239A	probably damaging	Het
Olfr173	A	G	16: 58,797,252	V198A	probably benign	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pcdh18	T	A	3: 49,753,379	D882V	probably damaging	Het
Pik3cg	C	T	12: 32,195,646	G868S	probably null	Het
Plppr5	T	G	3: 117,662,523	M231R	probably damaging	Het
Polr2a	T	C	11: 69,748,071	T46A	probably benign	Het
Ppp4r3a	C	A	12: 101,051,571	R440L	probably damaging	Het
Serpinb9e	A	T	13: 33,260,088	T364S	probably benign	Het
Sirt3	A	G	7: 140,869,628	V135A	possibly damaging	Het
Supt16	T	C	14: 52,171,439	N826S	probably null	Het
Tbr1	T	C	2: 61,804,739	I11T	probably benign	Het
Trim72	A	G	7: 128,010,247	E407G	possibly damaging	Het

Other mutations in Vps72

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02051:Vps72	APN	3	95122729	missense	possibly damaging	0.96
IGL02802:Vps72	UTSW	3	95119234	nonsense	probably null
R0135:Vps72	UTSW	3	95119197	missense	probably damaging	0.99
R0197:Vps72	UTSW	3	95122583	missense	probably damaging	0.97
R0463:Vps72	UTSW	3	95121304	missense	probably benign	0.41
R0883:Vps72	UTSW	3	95122583	missense	probably damaging	0.97
R1484:Vps72	UTSW	3	95119151	missense	probably damaging	1.00
R1698:Vps72	UTSW	3	95118695	missense	probably benign	0.00
R1839:Vps72	UTSW	3	95119218	missense	possibly damaging	0.70
R1935:Vps72	UTSW	3	95122540	missense	probably benign	0.01
R1936:Vps72	UTSW	3	95122540	missense	probably benign	0.01
R3011:Vps72	UTSW	3	95119274	missense	probably damaging	1.00
R4877:Vps72	UTSW	3	95118187	intron	probably benign
RF018:Vps72	UTSW	3	95121408	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CAGGACGATGGCTCTGACAGTG -3'
(R):5'- TCGTGTTTCAAGACAAAGCCCCTTC -3'

Sequencing Primer
(F):5'- gctctgattccagccctcc -3'
(R):5'- AAAGCCCCTTCTACAGAGTCTTG -3'

Posted On

2014-01-05