Incidental Mutation 'R1101:Sirt3'
ID98092
Institutional Source Beutler Lab
Gene Symbol Sirt3
Ensembl Gene ENSMUSG00000025486
Gene Namesirtuin 3
SynonymsSir2l3, 2310003L23Rik
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1101 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140863666-140882309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140869628 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 135 (V135A)
Ref Sequence ENSEMBL: ENSMUSP00000147504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026559] [ENSMUST00000106048] [ENSMUST00000137024] [ENSMUST00000147331] [ENSMUST00000210296] [ENSMUST00000211179]
Predicted Effect probably benign
Transcript: ENSMUST00000026559
AA Change: V135A

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026559
Gene: ENSMUSG00000025486
AA Change: V135A

DomainStartEndE-ValueType
Pfam:SIR2 3 184 5.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106048
AA Change: V135A

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101663
Gene: ENSMUSG00000025486
AA Change: V135A

DomainStartEndE-ValueType
Pfam:SIR2 3 184 8.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137024
SMART Domains Protein: ENSMUSP00000114247
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 178 1.7e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147331
AA Change: V212A

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121151
Gene: ENSMUSG00000025486
AA Change: V212A

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
Pfam:SIR2 80 258 1.9e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000210296
AA Change: V135A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210706
Predicted Effect possibly damaging
Transcript: ENSMUST00000211179
AA Change: V135A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Two alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one null allele exhibit increased systolic blood pressure while mice homozygous for another allele exhibit reduced ATP production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Sirt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Sirt3 APN 7 140864093 splice site probably benign
IGL03100:Sirt3 APN 7 140865117 missense probably damaging 1.00
R0478:Sirt3 UTSW 7 140878114 missense probably benign
R0549:Sirt3 UTSW 7 140869487 critical splice donor site probably null
R3983:Sirt3 UTSW 7 140878112 nonsense probably null
R4461:Sirt3 UTSW 7 140865000 missense possibly damaging 0.74
R5369:Sirt3 UTSW 7 140869493 missense probably damaging 1.00
R5452:Sirt3 UTSW 7 140865015 missense probably damaging 1.00
R7313:Sirt3 UTSW 7 140878126 missense
R7755:Sirt3 UTSW 7 140878050 missense
Predicted Primers PCR Primer
(F):5'- TGAAAAGGTGACACCGTCAACCAG -3'
(R):5'- TGTTCAAGACGCCTACAAAGCACTC -3'

Sequencing Primer
(F):5'- GTCAACCAGGCCCTAGC -3'
(R):5'- GCTCCCCACATCTAAGAAATAGTTG -3'
Posted On2014-01-05