Incidental Mutation 'R1101:Ogfod1'
ID98095
Institutional Source Beutler Lab
Gene Symbol Ogfod1
Ensembl Gene ENSMUSG00000033009
Gene Name2-oxoglutarate and iron-dependent oxygenase domain containing 1
Synonyms4930415J21Rik
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1101 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94037198-94067921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94064304 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 534 (S534R)
Ref Sequence ENSEMBL: ENSMUSP00000105183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034206] [ENSMUST00000060632] [ENSMUST00000093301] [ENSMUST00000109556]
Predicted Effect probably benign
Transcript: ENSMUST00000034206
SMART Domains Protein: ENSMUSP00000034206
Gene: ENSMUSG00000031755

DomainStartEndE-ValueType
Pfam:BBS2_N 20 161 1.4e-62 PFAM
Pfam:BBS2_Mid 162 272 6.9e-50 PFAM
Pfam:BBS2_C 276 715 2.6e-193 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060632
AA Change: S519R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051430
Gene: ENSMUSG00000033009
AA Change: S519R

DomainStartEndE-ValueType
P4Hc 46 223 4.87e-26 SMART
Pfam:Ofd1_CTDD 246 513 1.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093301
AA Change: S491R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090991
Gene: ENSMUSG00000033009
AA Change: S491R

DomainStartEndE-ValueType
P4Hc 61 228 2.6e-12 SMART
low complexity region 328 353 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109556
AA Change: S534R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105183
Gene: ENSMUSG00000033009
AA Change: S534R

DomainStartEndE-ValueType
P4Hc 61 238 4.87e-26 SMART
Pfam:Ofd1_CTDD 261 528 7.2e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170208
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Ogfod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Ogfod1 APN 8 94063006 missense probably damaging 1.00
IGL01296:Ogfod1 APN 8 94055671 splice site probably benign
IGL01369:Ogfod1 APN 8 94063091 critical splice donor site probably null
IGL02113:Ogfod1 APN 8 94064213 missense probably damaging 1.00
IGL02228:Ogfod1 APN 8 94062987 missense probably benign 0.00
IGL03057:Ogfod1 APN 8 94056138 missense possibly damaging 0.78
IGL03071:Ogfod1 APN 8 94057767 missense probably damaging 1.00
R0391:Ogfod1 UTSW 8 94063023 missense probably damaging 1.00
R0395:Ogfod1 UTSW 8 94063528 critical splice donor site probably null
R0518:Ogfod1 UTSW 8 94055248 splice site probably null
R0605:Ogfod1 UTSW 8 94047267 splice site probably benign
R0708:Ogfod1 UTSW 8 94039045 missense possibly damaging 0.89
R0763:Ogfod1 UTSW 8 94055636 missense probably benign 0.03
R1244:Ogfod1 UTSW 8 94037371 missense probably benign
R1332:Ogfod1 UTSW 8 94058099 missense probably damaging 1.00
R1336:Ogfod1 UTSW 8 94058099 missense probably damaging 1.00
R2301:Ogfod1 UTSW 8 94037368 missense probably damaging 0.99
R3025:Ogfod1 UTSW 8 94063052 missense probably damaging 1.00
R3710:Ogfod1 UTSW 8 94057752 nonsense probably null
R4612:Ogfod1 UTSW 8 94037347 missense possibly damaging 0.66
R5349:Ogfod1 UTSW 8 94055248 splice site probably benign
R5495:Ogfod1 UTSW 8 94064278 missense probably benign 0.30
R5690:Ogfod1 UTSW 8 94058141 missense probably damaging 0.99
R6355:Ogfod1 UTSW 8 94062982 missense probably benign
R7282:Ogfod1 UTSW 8 94037439 missense possibly damaging 0.47
R7396:Ogfod1 UTSW 8 94038987 missense probably benign 0.00
X0027:Ogfod1 UTSW 8 94037404 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AACCACCTGCTCTGTGATGACTCC -3'
(R):5'- CGCCAAGGCAGTTACTACAGAACG -3'

Sequencing Primer
(F):5'- TCTGTGATGACTCCCCCGAG -3'
(R):5'- tcccctttctctgcctcc -3'
Posted On2014-01-05