Mutagenetix > Incidental Mutation

Incidental Mutation 'R1101:Cdh15'

98097

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

039174-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1101 (G1)

Quality Score

131

Status

Not validated

Chromosome

Chromosomal Location

123575113-123594136 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 123587585 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 170 (V170I)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

AlphaFold

P33146

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034443
AA Change: V170I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: V170I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,853,909 (GRCm39)	I249M	possibly damaging	Het
2610021A01Rik	C	A	7: 41,276,783 (GRCm39)	H829N	probably damaging	Het
4930433I11Rik	A	T	7: 40,642,480 (GRCm39)	T141S	probably benign	Het
Abi3bp	G	T	16: 56,426,521 (GRCm39)	R512L	probably damaging	Het
Acot2	T	G	12: 84,039,624 (GRCm39)	S378A	probably benign	Het
Akap9	T	C	5: 4,096,205 (GRCm39)	I2360T	probably benign	Het
Bank1	T	C	3: 135,989,625 (GRCm39)	D155G	probably benign	Het
Bsn	A	G	9: 107,993,610 (GRCm39)	V714A	probably damaging	Het
Clcn2	G	A	16: 20,522,345 (GRCm39)	T787I	probably damaging	Het
Dapk1	A	G	13: 60,864,599 (GRCm39)	H131R	probably damaging	Het
Dct	T	G	14: 118,274,034 (GRCm39)	D291A	probably damaging	Het
Dhx37	A	G	5: 125,492,216 (GRCm39)	Y1128H	probably damaging	Het
Dip2c	A	T	13: 9,684,780 (GRCm39)	I1174F	probably damaging	Het
Eif3l	A	G	15: 78,959,467 (GRCm39)	Y3C	probably damaging	Het
Enpp5	A	G	17: 44,392,258 (GRCm39)	N229S	possibly damaging	Het
Fam83b	A	T	9: 76,452,952 (GRCm39)	H38Q	possibly damaging	Het
Fcamr	T	A	1: 130,742,223 (GRCm39)		probably null	Het
Hdac2	G	A	10: 36,867,805 (GRCm39)	V184I	probably damaging	Het
Igf2bp2	A	T	16: 21,981,700 (GRCm39)	L5Q	probably damaging	Het
Iqca1	C	A	1: 90,070,453 (GRCm39)	G133V	probably null	Het
Ireb2	T	A	9: 54,816,986 (GRCm39)	H951Q	probably benign	Het
Lman1	T	A	18: 66,120,969 (GRCm39)	M418L	probably benign	Het
Lrrfip2	C	T	9: 111,019,293 (GRCm39)	R275W	probably damaging	Het
Mast3	T	A	8: 71,239,307 (GRCm39)	I424F	probably damaging	Het
Mep1a	T	C	17: 43,802,584 (GRCm39)	D147G	probably benign	Het
Mtr	C	A	13: 12,204,411 (GRCm39)	E1128D	possibly damaging	Het
Ogfod1	C	A	8: 94,790,932 (GRCm39)	S534R	probably benign	Het
Or4c107	A	T	2: 88,789,328 (GRCm39)	I173F	possibly damaging	Het
Or4k42	T	C	2: 111,319,787 (GRCm39)	T239A	probably damaging	Het
Or5k1	A	G	16: 58,617,615 (GRCm39)	V198A	probably benign	Het
Oxtr	C	T	6: 112,454,138 (GRCm39)	R42Q	probably benign	Het
Pcdh18	T	A	3: 49,707,828 (GRCm39)	D882V	probably damaging	Het
Pik3cg	C	T	12: 32,245,645 (GRCm39)	G868S	probably null	Het
Plppr5	T	G	3: 117,456,172 (GRCm39)	M231R	probably damaging	Het
Polr2a	T	C	11: 69,638,897 (GRCm39)	T46A	probably benign	Het
Ppp4r3a	C	A	12: 101,017,830 (GRCm39)	R440L	probably damaging	Het
Serpinb9e	A	T	13: 33,444,071 (GRCm39)	T364S	probably benign	Het
Sirt3	A	G	7: 140,449,541 (GRCm39)	V135A	possibly damaging	Het
Supt16	T	C	14: 52,408,896 (GRCm39)	N826S	probably null	Het
Tbr1	T	C	2: 61,635,083 (GRCm39)	I11T	probably benign	Het
Trim72	A	G	7: 127,609,419 (GRCm39)	E407G	possibly damaging	Het
Vps72	C	A	3: 95,026,487 (GRCm39)	T144K	probably damaging	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	123,592,062 (GRCm39)	intron	probably benign
IGL01958:Cdh15	APN	8	123,586,089 (GRCm39)	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	123,583,291 (GRCm39)	nonsense	probably null
IGL02793:Cdh15	APN	8	123,587,721 (GRCm39)	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	123,592,111 (GRCm39)	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	123,592,175 (GRCm39)	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	123,587,705 (GRCm39)	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	123,588,188 (GRCm39)	intron	probably benign
R0898:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	123,591,939 (GRCm39)	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	123,591,076 (GRCm39)	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R1081:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	123,588,188 (GRCm39)	intron	probably benign
R1317:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	123,588,755 (GRCm39)	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	123,591,715 (GRCm39)	splice site	probably null
R2252:Cdh15	UTSW	8	123,584,161 (GRCm39)	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	123,586,056 (GRCm39)	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	123,590,162 (GRCm39)	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	123,590,162 (GRCm39)	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	123,591,897 (GRCm39)	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	123,591,767 (GRCm39)	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	123,587,612 (GRCm39)	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	123,591,087 (GRCm39)	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	123,588,802 (GRCm39)	missense	probably null	1.00
R5375:Cdh15	UTSW	8	123,591,839 (GRCm39)	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	123,591,917 (GRCm39)	missense	possibly damaging	0.79
R5778:Cdh15	UTSW	8	123,583,326 (GRCm39)	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	123,591,086 (GRCm39)	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	123,584,130 (GRCm39)	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	123,590,294 (GRCm39)	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	123,575,231 (GRCm39)	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	123,588,865 (GRCm39)	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	123,593,700 (GRCm39)	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	123,593,574 (GRCm39)	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	123,584,105 (GRCm39)	missense	probably damaging	1.00
R8759:Cdh15	UTSW	8	123,587,628 (GRCm39)	missense	probably damaging	1.00
R8910:Cdh15	UTSW	8	123,575,240 (GRCm39)	missense	probably benign	0.04
R9017:Cdh15	UTSW	8	123,584,256 (GRCm39)	critical splice donor site	probably null
R9453:Cdh15	UTSW	8	123,586,029 (GRCm39)	missense	probably damaging	0.99
R9699:Cdh15	UTSW	8	123,588,769 (GRCm39)	missense	probably benign	0.00
R9705:Cdh15	UTSW	8	123,591,024 (GRCm39)	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	123,590,998 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAATGGGGCTGTGTTGACCTCAG -3'
(R):5'- ATTGCACCAGCAAGGAAGGACC -3'

Sequencing Primer
(F):5'- AGTTCCACCATAGTCATGGTC -3'
(R):5'- CCCAATGTGGAGAACTGGC -3'

Posted On

2014-01-05