Incidental Mutation 'R1101:Ireb2'
ID98099
Institutional Source Beutler Lab
Gene Symbol Ireb2
Ensembl Gene ENSMUSG00000032293
Gene Nameiron responsive element binding protein 2
SynonymsD9Ertd85e, Irp2
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1101 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location54863789-54912530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54909702 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 951 (H951Q)
Ref Sequence ENSEMBL: ENSMUSP00000034843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034843]
Predicted Effect probably benign
Transcript: ENSMUST00000034843
AA Change: H951Q

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034843
Gene: ENSMUSG00000032293
AA Change: H951Q

DomainStartEndE-ValueType
Pfam:Aconitase 59 155 6.5e-16 PFAM
Pfam:Aconitase 186 639 2e-129 PFAM
Pfam:Aconitase_C 767 896 1.5e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213482
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in microcytic anemia, altered body iron homeostasis, and variable behavioral and neurological phenotypes that may include pathological signs of neurodegeneration or brain iron accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Ireb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ireb2 APN 9 54899482 splice site probably benign
IGL01576:Ireb2 APN 9 54892510 missense probably damaging 1.00
IGL01844:Ireb2 APN 9 54865357 missense probably benign 0.01
homicidal UTSW 9 54886567 nonsense probably null
remorseless UTSW 9 54882333 missense possibly damaging 0.83
tony_stark UTSW 9 54903961 missense probably damaging 1.00
R0143:Ireb2 UTSW 9 54885909 missense probably benign 0.06
R0279:Ireb2 UTSW 9 54886593 missense probably benign
R0400:Ireb2 UTSW 9 54896498 missense probably benign
R0565:Ireb2 UTSW 9 54899983 missense probably damaging 1.00
R0686:Ireb2 UTSW 9 54904176 missense probably benign 0.44
R0706:Ireb2 UTSW 9 54892486 missense probably benign
R0894:Ireb2 UTSW 9 54896577 missense probably damaging 1.00
R1680:Ireb2 UTSW 9 54881518 missense probably damaging 1.00
R2074:Ireb2 UTSW 9 54881449 missense probably benign
R2080:Ireb2 UTSW 9 54896552 missense possibly damaging 0.85
R2891:Ireb2 UTSW 9 54899990 missense probably benign 0.01
R3153:Ireb2 UTSW 9 54885946 critical splice donor site probably null
R3154:Ireb2 UTSW 9 54885946 critical splice donor site probably null
R3844:Ireb2 UTSW 9 54892505 missense probably damaging 0.99
R4128:Ireb2 UTSW 9 54881432 missense probably benign 0.32
R4803:Ireb2 UTSW 9 54906814 missense probably benign 0.01
R5097:Ireb2 UTSW 9 54895384 missense probably benign 0.04
R5159:Ireb2 UTSW 9 54892547 missense probably benign
R5227:Ireb2 UTSW 9 54896601 critical splice donor site probably null
R5767:Ireb2 UTSW 9 54900516 missense probably benign
R6005:Ireb2 UTSW 9 54908805 missense probably damaging 1.00
R6127:Ireb2 UTSW 9 54882368 missense probably benign
R6155:Ireb2 UTSW 9 54886527 missense probably damaging 1.00
R6170:Ireb2 UTSW 9 54887372 missense probably benign 0.00
R6341:Ireb2 UTSW 9 54908780 missense probably damaging 0.99
R6707:Ireb2 UTSW 9 54903961 missense probably damaging 1.00
R6973:Ireb2 UTSW 9 54882387 missense probably benign 0.00
R7108:Ireb2 UTSW 9 54906641 missense probably damaging 1.00
R7126:Ireb2 UTSW 9 54886567 nonsense probably null
R7314:Ireb2 UTSW 9 54892510 missense probably damaging 1.00
R7396:Ireb2 UTSW 9 54882333 missense possibly damaging 0.83
R7472:Ireb2 UTSW 9 54884054 missense probably benign 0.11
R7590:Ireb2 UTSW 9 54896495 missense probably benign 0.00
R7842:Ireb2 UTSW 9 54909686 missense probably benign 0.01
R7894:Ireb2 UTSW 9 54882336 missense probably damaging 1.00
R7925:Ireb2 UTSW 9 54909686 missense probably benign 0.01
R7977:Ireb2 UTSW 9 54882336 missense probably damaging 1.00
RF006:Ireb2 UTSW 9 54881484 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GTGTAGACTTACAGGGCTGATAGTTGC -3'
(R):5'- CCACAACACACTTCACACGTTGATTTT -3'

Sequencing Primer
(F):5'- GTGTATTGCACAATCAAAATTTGGG -3'
(R):5'- GCAATGTTAATAGCACCATTCGTG -3'
Posted On2014-01-05