Incidental Mutation 'R1101:Pik3cg'
ID98116
Institutional Source Beutler Lab
Gene Symbol Pik3cg
Ensembl Gene ENSMUSG00000020573
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma
SynonymsPI(3)Kgamma, p110gamma, 5830428L06Rik, PI3K, PI3Kgamma
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1101 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location32173473-32208659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32195646 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 868 (G868S)
Ref Sequence ENSEMBL: ENSMUSP00000151400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053215] [ENSMUST00000085469] [ENSMUST00000156904] [ENSMUST00000217915] [ENSMUST00000220366]
Predicted Effect probably null
Transcript: ENSMUST00000053215
AA Change: G868S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062864
Gene: ENSMUSG00000020573
AA Change: G868S

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000085469
AA Change: G868S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082596
Gene: ENSMUSG00000020573
AA Change: G868S

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126814
Predicted Effect probably damaging
Transcript: ENSMUST00000156904
AA Change: G868S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123539
Gene: ENSMUSG00000020573
AA Change: G868S

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217915
AA Change: G868S

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably null
Transcript: ENSMUST00000220366
AA Change: G868S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in thymocyte development, T cell activation, and neutrophil migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Pik3cg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pik3cg APN 12 32205149 missense probably damaging 1.00
IGL02182:Pik3cg APN 12 32205273 missense possibly damaging 0.90
IGL02273:Pik3cg APN 12 32176810 missense probably damaging 1.00
IGL02312:Pik3cg APN 12 32194821 missense possibly damaging 0.55
IGL02752:Pik3cg APN 12 32204263 missense probably damaging 1.00
IGL03107:Pik3cg APN 12 32200595 missense probably damaging 1.00
IGL03139:Pik3cg APN 12 32192223 missense probably damaging 1.00
IGL03267:Pik3cg APN 12 32205308 missense possibly damaging 0.94
IGL03367:Pik3cg APN 12 32192121 missense probably benign 0.01
PIT4283001:Pik3cg UTSW 12 32205865 missense probably damaging 1.00
PIT4472001:Pik3cg UTSW 12 32204984 missense probably damaging 0.99
PIT4514001:Pik3cg UTSW 12 32204903 missense probably damaging 1.00
R0112:Pik3cg UTSW 12 32195715 splice site probably benign
R0145:Pik3cg UTSW 12 32204322 missense probably benign 0.20
R0279:Pik3cg UTSW 12 32204791 missense probably damaging 1.00
R0471:Pik3cg UTSW 12 32194771 missense probably damaging 0.99
R0494:Pik3cg UTSW 12 32204546 missense possibly damaging 0.84
R0573:Pik3cg UTSW 12 32197197 missense probably damaging 1.00
R0631:Pik3cg UTSW 12 32205203 missense probably benign
R0699:Pik3cg UTSW 12 32197342 splice site probably benign
R0826:Pik3cg UTSW 12 32195673 missense possibly damaging 0.78
R1076:Pik3cg UTSW 12 32195714 splice site probably benign
R1459:Pik3cg UTSW 12 32204984 missense probably damaging 0.99
R1625:Pik3cg UTSW 12 32194742 missense probably damaging 1.00
R1971:Pik3cg UTSW 12 32192153 missense probably damaging 1.00
R1992:Pik3cg UTSW 12 32204025 missense possibly damaging 0.83
R2109:Pik3cg UTSW 12 32193710 missense possibly damaging 0.75
R2319:Pik3cg UTSW 12 32176736 missense probably damaging 0.99
R3421:Pik3cg UTSW 12 32204739 missense probably damaging 1.00
R3422:Pik3cg UTSW 12 32204739 missense probably damaging 1.00
R3740:Pik3cg UTSW 12 32205224 missense probably damaging 1.00
R3777:Pik3cg UTSW 12 32194709 missense probably damaging 0.98
R4300:Pik3cg UTSW 12 32176672 missense probably damaging 1.00
R4395:Pik3cg UTSW 12 32204092 missense probably damaging 1.00
R4725:Pik3cg UTSW 12 32193597 critical splice donor site probably null
R4785:Pik3cg UTSW 12 32205199 missense probably damaging 0.97
R4809:Pik3cg UTSW 12 32204081 missense possibly damaging 0.46
R4981:Pik3cg UTSW 12 32204104 missense possibly damaging 0.77
R5033:Pik3cg UTSW 12 32199196 splice site probably null
R5161:Pik3cg UTSW 12 32204978 missense possibly damaging 0.92
R5806:Pik3cg UTSW 12 32204953 missense possibly damaging 0.88
R6136:Pik3cg UTSW 12 32204359 missense probably benign 0.00
R6746:Pik3cg UTSW 12 32194758 missense probably damaging 1.00
R6895:Pik3cg UTSW 12 32204347 missense possibly damaging 0.87
R7000:Pik3cg UTSW 12 32192129 missense probably damaging 1.00
R7089:Pik3cg UTSW 12 32176846 missense probably benign 0.00
R7113:Pik3cg UTSW 12 32205667 missense probably damaging 0.98
R7372:Pik3cg UTSW 12 32197197 missense probably damaging 1.00
R7483:Pik3cg UTSW 12 32195648 missense probably damaging 0.99
R7596:Pik3cg UTSW 12 32204741 missense probably damaging 1.00
R7771:Pik3cg UTSW 12 32204014 missense probably benign
R7910:Pik3cg UTSW 12 32200517 missense probably benign 0.16
R7991:Pik3cg UTSW 12 32200517 missense probably benign 0.16
Z1176:Pik3cg UTSW 12 32204795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACCGAGAGTCTCTTTCCAGCC -3'
(R):5'- TGGAGCCCACTATGCACTGAAAC -3'

Sequencing Primer
(F):5'- AGCCTGGGAACATTTCCTC -3'
(R):5'- AGCAACCAGTTAATGTTTGGG -3'
Posted On2014-01-05