Mutagenetix > Incidental Mutations

Incidental Mutation 'R1101:Pik3cg'

98116

Institutional Source

Beutler Lab

Gene Symbol

Pik3cg

Ensembl Gene

ENSMUSG00000020573

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma

Synonyms

PI(3)Kgamma, p110gamma, 5830428L06Rik, PI3K, PI3Kgamma

MMRRC Submission

039174-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1101 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32173473-32208659 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 32195646 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 868 (G868S)

Ref Sequence

ENSEMBL: ENSMUSP00000151400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053215] [ENSMUST00000085469] [ENSMUST00000156904] [ENSMUST00000217915] [ENSMUST00000220366]

Predicted Effect

probably null
Transcript: ENSMUST00000053215
AA Change: G868S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000062864
Gene: ENSMUSG00000020573
AA Change: G868S

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000085469
AA Change: G868S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082596
Gene: ENSMUSG00000020573
AA Change: G868S

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126814

Predicted Effect

probably damaging
Transcript: ENSMUST00000156904
AA Change: G868S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000123539
Gene: ENSMUSG00000020573
AA Change: G868S

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000217915
AA Change: G868S

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably null
Transcript: ENSMUST00000220366
AA Change: G868S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in thymocyte development, T cell activation, and neutrophil migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2610021A01Rik	C	A	7: 41,627,359	H829N	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abi3bp	G	T	16: 56,606,158	R512L	probably damaging	Het
Acot2	T	G	12: 83,992,850	S378A	probably benign	Het
Akap9	T	C	5: 4,046,205	I2360T	probably benign	Het
Bank1	T	C	3: 136,283,864	D155G	probably benign	Het
Bsn	A	G	9: 108,116,411	V714A	probably damaging	Het
Cdh15	G	A	8: 122,860,846	V170I	possibly damaging	Het
Clcn2	G	A	16: 20,703,595	T787I	probably damaging	Het
Dapk1	A	G	13: 60,716,785	H131R	probably damaging	Het
Dct	T	G	14: 118,036,622	D291A	probably damaging	Het
Dhx37	A	G	5: 125,415,152	Y1128H	probably damaging	Het
Dip2c	A	T	13: 9,634,744	I1174F	probably damaging	Het
Eif3l	A	G	15: 79,075,267	Y3C	probably damaging	Het
Enpp5	A	G	17: 44,081,367	N229S	possibly damaging	Het
Fam83b	A	T	9: 76,545,670	H38Q	possibly damaging	Het
Fcamr	T	A	1: 130,814,486		probably null	Het
Hdac2	G	A	10: 36,991,809	V184I	probably damaging	Het
Igf2bp2	A	T	16: 22,162,950	L5Q	probably damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Ireb2	T	A	9: 54,909,702	H951Q	probably benign	Het
Lman1	T	A	18: 65,987,898	M418L	probably benign	Het
Lrrfip2	C	T	9: 111,190,225	R275W	probably damaging	Het
Mast3	T	A	8: 70,786,663	I424F	probably damaging	Het
Mep1a	T	C	17: 43,491,693	D147G	probably benign	Het
Mtr	C	A	13: 12,189,525	E1128D	possibly damaging	Het
Ogfod1	C	A	8: 94,064,304	S534R	probably benign	Het
Olfr1212	A	T	2: 88,958,984	I173F	possibly damaging	Het
Olfr1290	T	C	2: 111,489,442	T239A	probably damaging	Het
Olfr173	A	G	16: 58,797,252	V198A	probably benign	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pcdh18	T	A	3: 49,753,379	D882V	probably damaging	Het
Plppr5	T	G	3: 117,662,523	M231R	probably damaging	Het
Polr2a	T	C	11: 69,748,071	T46A	probably benign	Het
Ppp4r3a	C	A	12: 101,051,571	R440L	probably damaging	Het
Serpinb9e	A	T	13: 33,260,088	T364S	probably benign	Het
Sirt3	A	G	7: 140,869,628	V135A	possibly damaging	Het
Supt16	T	C	14: 52,171,439	N826S	probably null	Het
Tbr1	T	C	2: 61,804,739	I11T	probably benign	Het
Trim72	A	G	7: 128,010,247	E407G	possibly damaging	Het
Vps72	C	A	3: 95,119,176	T144K	probably damaging	Het

Other mutations in Pik3cg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Pik3cg	APN	12	32205149	missense	probably damaging	1.00
IGL02182:Pik3cg	APN	12	32205273	missense	possibly damaging	0.90
IGL02273:Pik3cg	APN	12	32176810	missense	probably damaging	1.00
IGL02312:Pik3cg	APN	12	32194821	missense	possibly damaging	0.55
IGL02752:Pik3cg	APN	12	32204263	missense	probably damaging	1.00
IGL03107:Pik3cg	APN	12	32200595	missense	probably damaging	1.00
IGL03139:Pik3cg	APN	12	32192223	missense	probably damaging	1.00
IGL03267:Pik3cg	APN	12	32205308	missense	possibly damaging	0.94
IGL03367:Pik3cg	APN	12	32192121	missense	probably benign	0.01
PIT4283001:Pik3cg	UTSW	12	32205865	missense	probably damaging	1.00
PIT4472001:Pik3cg	UTSW	12	32204984	missense	probably damaging	0.99
PIT4514001:Pik3cg	UTSW	12	32204903	missense	probably damaging	1.00
R0112:Pik3cg	UTSW	12	32195715	splice site	probably benign
R0145:Pik3cg	UTSW	12	32204322	missense	probably benign	0.20
R0279:Pik3cg	UTSW	12	32204791	missense	probably damaging	1.00
R0471:Pik3cg	UTSW	12	32194771	missense	probably damaging	0.99
R0494:Pik3cg	UTSW	12	32204546	missense	possibly damaging	0.84
R0573:Pik3cg	UTSW	12	32197197	missense	probably damaging	1.00
R0631:Pik3cg	UTSW	12	32205203	missense	probably benign
R0699:Pik3cg	UTSW	12	32197342	splice site	probably benign
R0826:Pik3cg	UTSW	12	32195673	missense	possibly damaging	0.78
R1076:Pik3cg	UTSW	12	32195714	splice site	probably benign
R1459:Pik3cg	UTSW	12	32204984	missense	probably damaging	0.99
R1625:Pik3cg	UTSW	12	32194742	missense	probably damaging	1.00
R1971:Pik3cg	UTSW	12	32192153	missense	probably damaging	1.00
R1992:Pik3cg	UTSW	12	32204025	missense	possibly damaging	0.83
R2109:Pik3cg	UTSW	12	32193710	missense	possibly damaging	0.75
R2319:Pik3cg	UTSW	12	32176736	missense	probably damaging	0.99
R3421:Pik3cg	UTSW	12	32204739	missense	probably damaging	1.00
R3422:Pik3cg	UTSW	12	32204739	missense	probably damaging	1.00
R3740:Pik3cg	UTSW	12	32205224	missense	probably damaging	1.00
R3777:Pik3cg	UTSW	12	32194709	missense	probably damaging	0.98
R4300:Pik3cg	UTSW	12	32176672	missense	probably damaging	1.00
R4395:Pik3cg	UTSW	12	32204092	missense	probably damaging	1.00
R4725:Pik3cg	UTSW	12	32193597	critical splice donor site	probably null
R4785:Pik3cg	UTSW	12	32205199	missense	probably damaging	0.97
R4809:Pik3cg	UTSW	12	32204081	missense	possibly damaging	0.46
R4981:Pik3cg	UTSW	12	32204104	missense	possibly damaging	0.77
R5033:Pik3cg	UTSW	12	32199196	splice site	probably null
R5161:Pik3cg	UTSW	12	32204978	missense	possibly damaging	0.92
R5806:Pik3cg	UTSW	12	32204953	missense	possibly damaging	0.88
R6136:Pik3cg	UTSW	12	32204359	missense	probably benign	0.00
R6746:Pik3cg	UTSW	12	32194758	missense	probably damaging	1.00
R6895:Pik3cg	UTSW	12	32204347	missense	possibly damaging	0.87
R7000:Pik3cg	UTSW	12	32192129	missense	probably damaging	1.00
R7089:Pik3cg	UTSW	12	32176846	missense	probably benign	0.00
R7113:Pik3cg	UTSW	12	32205667	missense	probably damaging	0.98
R7372:Pik3cg	UTSW	12	32197197	missense	probably damaging	1.00
R7483:Pik3cg	UTSW	12	32195648	missense	probably damaging	0.99
R7596:Pik3cg	UTSW	12	32204741	missense	probably damaging	1.00
R7771:Pik3cg	UTSW	12	32204014	missense	probably benign
R7910:Pik3cg	UTSW	12	32200517	missense	probably benign	0.16
R7974:Pik3cg	UTSW	12	32204032	missense	probably benign	0.00
R8084:Pik3cg	UTSW	12	32195688	missense	probably benign	0.30
R8352:Pik3cg	UTSW	12	32193640	missense	probably damaging	1.00
R8452:Pik3cg	UTSW	12	32193640	missense	probably damaging	1.00
Z1176:Pik3cg	UTSW	12	32204795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAACCGAGAGTCTCTTTCCAGCC -3'
(R):5'- TGGAGCCCACTATGCACTGAAAC -3'

Sequencing Primer
(F):5'- AGCCTGGGAACATTTCCTC -3'
(R):5'- AGCAACCAGTTAATGTTTGGG -3'

Posted On

2014-01-05