Incidental Mutation 'R1101:Ppp4r3a'
ID 98119
Institutional Source Beutler Lab
Gene Symbol Ppp4r3a
Ensembl Gene ENSMUSG00000041846
Gene Name protein phosphatase 4 regulatory subunit 3A
Synonyms 1110034C04Rik, Smek1
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R1101 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 101039409-101083702 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 101051571 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 440 (R440L)
Ref Sequence ENSEMBL: ENSMUSP00000041667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048305] [ENSMUST00000163095] [ENSMUST00000223091]
AlphaFold Q6P2K6
Predicted Effect probably damaging
Transcript: ENSMUST00000048305
AA Change: R440L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041667
Gene: ENSMUSG00000041846
AA Change: R440L

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 3e-24 SMART
Pfam:SMK-1 164 357 5.8e-85 PFAM
low complexity region 407 418 N/A INTRINSIC
low complexity region 495 503 N/A INTRINSIC
low complexity region 705 720 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163095
AA Change: R453L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000129654
Gene: ENSMUSG00000041846
AA Change: R453L

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 4e-24 SMART
Pfam:SMK-1 166 357 2.5e-84 PFAM
low complexity region 508 516 N/A INTRINSIC
low complexity region 718 733 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 808 821 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222956
Predicted Effect probably benign
Transcript: ENSMUST00000223091
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Ppp4r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ppp4r3a APN 12 101049794 missense probably damaging 1.00
IGL00532:Ppp4r3a APN 12 101044653 missense probably damaging 1.00
IGL01359:Ppp4r3a APN 12 101058496 missense probably damaging 0.99
IGL01873:Ppp4r3a APN 12 101041835 missense possibly damaging 0.86
IGL02676:Ppp4r3a APN 12 101042511 missense probably benign 0.00
IGL02756:Ppp4r3a APN 12 101058323 critical splice donor site probably null
IGL03196:Ppp4r3a APN 12 101049654 splice site probably benign
IGL03206:Ppp4r3a APN 12 101058619 missense probably damaging 1.00
R1434:Ppp4r3a UTSW 12 101043524 missense probably damaging 0.99
R1526:Ppp4r3a UTSW 12 101040741 missense probably damaging 0.99
R1554:Ppp4r3a UTSW 12 101055822 missense probably damaging 1.00
R1650:Ppp4r3a UTSW 12 101044619 missense probably damaging 0.99
R1766:Ppp4r3a UTSW 12 101058482 missense probably damaging 0.99
R2152:Ppp4r3a UTSW 12 101042567 missense probably damaging 0.99
R2322:Ppp4r3a UTSW 12 101042619 missense probably damaging 0.98
R2421:Ppp4r3a UTSW 12 101042653 splice site probably benign
R2422:Ppp4r3a UTSW 12 101042653 splice site probably benign
R2859:Ppp4r3a UTSW 12 101042647 critical splice acceptor site probably null
R2884:Ppp4r3a UTSW 12 101068677 missense probably damaging 0.99
R4157:Ppp4r3a UTSW 12 101055619 missense probably damaging 0.97
R4651:Ppp4r3a UTSW 12 101082911 utr 5 prime probably benign
R4652:Ppp4r3a UTSW 12 101082911 utr 5 prime probably benign
R4706:Ppp4r3a UTSW 12 101041916 missense probably damaging 1.00
R4773:Ppp4r3a UTSW 12 101082767 missense possibly damaging 0.93
R4775:Ppp4r3a UTSW 12 101053566 missense probably damaging 0.99
R5467:Ppp4r3a UTSW 12 101043470 missense probably damaging 0.99
R5634:Ppp4r3a UTSW 12 101043521 missense probably damaging 1.00
R5704:Ppp4r3a UTSW 12 101083360 utr 5 prime probably benign
R5707:Ppp4r3a UTSW 12 101058511 missense probably damaging 1.00
R5935:Ppp4r3a UTSW 12 101051613 missense probably damaging 1.00
R5969:Ppp4r3a UTSW 12 101043579 missense probably benign
R6030:Ppp4r3a UTSW 12 101058400 missense probably damaging 0.97
R6030:Ppp4r3a UTSW 12 101058400 missense probably damaging 0.97
R6630:Ppp4r3a UTSW 12 101049776 missense probably damaging 1.00
R7265:Ppp4r3a UTSW 12 101053511 missense possibly damaging 0.77
R7352:Ppp4r3a UTSW 12 101041832 missense probably damaging 1.00
R7402:Ppp4r3a UTSW 12 101058794 missense possibly damaging 0.94
R7761:Ppp4r3a UTSW 12 101055821 missense probably damaging 0.98
R7808:Ppp4r3a UTSW 12 101053496 missense possibly damaging 0.94
R7811:Ppp4r3a UTSW 12 101053562 missense probably damaging 0.98
R8062:Ppp4r3a UTSW 12 101041971 missense probably damaging 0.98
R8409:Ppp4r3a UTSW 12 101042493 missense probably benign 0.02
R8435:Ppp4r3a UTSW 12 101082789 missense probably benign 0.19
R8471:Ppp4r3a UTSW 12 101055642 missense probably benign 0.01
R9010:Ppp4r3a UTSW 12 101058332 missense possibly damaging 0.58
R9137:Ppp4r3a UTSW 12 101055535 missense possibly damaging 0.95
R9335:Ppp4r3a UTSW 12 101040754 missense probably damaging 1.00
R9336:Ppp4r3a UTSW 12 101049660 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATACAGTGCTTGTAGAAGAAACCCA -3'
(R):5'- ACTGTCTTTGAACTACCCATCAGGGAA -3'

Sequencing Primer
(F):5'- GCTTGTAGAAGAAACCCAGAAATTC -3'
(R):5'- GGGAAAAGAGAAACTTCCATCTATC -3'
Posted On 2014-01-05