Mutagenetix > Incidental Mutation

Incidental Mutation 'R1101:Mtr'

98121

Institutional Source

Beutler Lab

Gene Symbol

Mtr

Ensembl Gene

ENSMUSG00000021311

Gene Name

5-methyltetrahydrofolate-homocysteine methyltransferase

Synonyms

methionine synthase, D830038K18Rik, MS

MMRRC Submission

039174-MU

Accession Numbers

Genbank: NM_001081128

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1101 (G1)

Quality Score

196

Status

Not validated

Chromosome

Chromosomal Location

12182712-12258113 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 12189525 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 1128 (E1128D)

Ref Sequence

ENSEMBL: ENSMUSP00000097442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099856]

AlphaFold

A6H5Y3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099856
AA Change: E1128D

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000097442
Gene: ENSMUSG00000021311
AA Change: E1128D

Domain	Start	End	E-Value	Type
Pfam:S-methyl_trans	18	326	1.5e-93	PFAM
Pfam:Pterin_bind	363	601	4.6e-63	PFAM
B12-binding_2	657	743	6.42e-41	SMART
Pfam:B12-binding	761	861	3.3e-20	PFAM
Pfam:Met_synt_B12	953	1234	2.5e-114	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220473

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221190

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 5-methyltetrahydrofolate-homocysteine methyltransferase. This enzyme, also known as cobalamin-dependent methionine synthase, catalyzes the final step in methionine biosynthesis. Mutations in MTR have been identified as the underlying cause of methylcobalamin deficiency complementation group G. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit embryonic lethality prior to E9.5. Heterozygous appear mostly similar to conrtols, except that they exhibit elevated plasma methionine and homocysteine levels. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2610021A01Rik	C	A	7: 41,627,359	H829N	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abi3bp	G	T	16: 56,606,158	R512L	probably damaging	Het
Acot2	T	G	12: 83,992,850	S378A	probably benign	Het
Akap9	T	C	5: 4,046,205	I2360T	probably benign	Het
Bank1	T	C	3: 136,283,864	D155G	probably benign	Het
Bsn	A	G	9: 108,116,411	V714A	probably damaging	Het
Cdh15	G	A	8: 122,860,846	V170I	possibly damaging	Het
Clcn2	G	A	16: 20,703,595	T787I	probably damaging	Het
Dapk1	A	G	13: 60,716,785	H131R	probably damaging	Het
Dct	T	G	14: 118,036,622	D291A	probably damaging	Het
Dhx37	A	G	5: 125,415,152	Y1128H	probably damaging	Het
Dip2c	A	T	13: 9,634,744	I1174F	probably damaging	Het
Eif3l	A	G	15: 79,075,267	Y3C	probably damaging	Het
Enpp5	A	G	17: 44,081,367	N229S	possibly damaging	Het
Fam83b	A	T	9: 76,545,670	H38Q	possibly damaging	Het
Fcamr	T	A	1: 130,814,486		probably null	Het
Hdac2	G	A	10: 36,991,809	V184I	probably damaging	Het
Igf2bp2	A	T	16: 22,162,950	L5Q	probably damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Ireb2	T	A	9: 54,909,702	H951Q	probably benign	Het
Lman1	T	A	18: 65,987,898	M418L	probably benign	Het
Lrrfip2	C	T	9: 111,190,225	R275W	probably damaging	Het
Mast3	T	A	8: 70,786,663	I424F	probably damaging	Het
Mep1a	T	C	17: 43,491,693	D147G	probably benign	Het
Ogfod1	C	A	8: 94,064,304	S534R	probably benign	Het
Olfr1212	A	T	2: 88,958,984	I173F	possibly damaging	Het
Olfr1290	T	C	2: 111,489,442	T239A	probably damaging	Het
Olfr173	A	G	16: 58,797,252	V198A	probably benign	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pcdh18	T	A	3: 49,753,379	D882V	probably damaging	Het
Pik3cg	C	T	12: 32,195,646	G868S	probably null	Het
Plppr5	T	G	3: 117,662,523	M231R	probably damaging	Het
Polr2a	T	C	11: 69,748,071	T46A	probably benign	Het
Ppp4r3a	C	A	12: 101,051,571	R440L	probably damaging	Het
Serpinb9e	A	T	13: 33,260,088	T364S	probably benign	Het
Sirt3	A	G	7: 140,869,628	V135A	possibly damaging	Het
Supt16	T	C	14: 52,171,439	N826S	probably null	Het
Tbr1	T	C	2: 61,804,739	I11T	probably benign	Het
Trim72	A	G	7: 128,010,247	E407G	possibly damaging	Het
Vps72	C	A	3: 95,119,176	T144K	probably damaging	Het

Other mutations in Mtr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01299:Mtr	APN	13	12225650	splice site	probably benign
IGL02456:Mtr	APN	13	12199094	missense	probably damaging	0.98
IGL02573:Mtr	APN	13	12199127	missense	possibly damaging	0.95
IGL02642:Mtr	APN	13	12195232	splice site	probably benign
IGL03005:Mtr	APN	13	12235449	splice site	probably benign
IGL03017:Mtr	APN	13	12247891	critical splice donor site	probably null
IGL03036:Mtr	APN	13	12247377	missense	probably damaging	1.00
H8930:Mtr	UTSW	13	12235460	missense	probably damaging	1.00
PIT4431001:Mtr	UTSW	13	12212443	missense	probably damaging	1.00
PIT4520001:Mtr	UTSW	13	12197985	nonsense	probably null
R0011:Mtr	UTSW	13	12238052	splice site	probably benign
R0047:Mtr	UTSW	13	12222226	missense	probably damaging	1.00
R0047:Mtr	UTSW	13	12222226	missense	probably damaging	1.00
R0304:Mtr	UTSW	13	12222154	critical splice donor site	probably null
R0617:Mtr	UTSW	13	12221432	missense	probably benign
R0842:Mtr	UTSW	13	12200247	missense	probably damaging	1.00
R1450:Mtr	UTSW	13	12193733	missense	probably damaging	0.99
R1534:Mtr	UTSW	13	12235544	splice site	probably benign
R1907:Mtr	UTSW	13	12225532	missense	probably damaging	1.00
R2111:Mtr	UTSW	13	12244601	missense	possibly damaging	0.86
R2354:Mtr	UTSW	13	12188157	splice site	probably benign
R3849:Mtr	UTSW	13	12247365	missense	probably benign	0.16
R3899:Mtr	UTSW	13	12216849	missense	probably benign	0.00
R4012:Mtr	UTSW	13	12189397	missense	probably damaging	1.00
R4012:Mtr	UTSW	13	12189398	missense	probably damaging	1.00
R4075:Mtr	UTSW	13	12215412	critical splice donor site	probably null
R4091:Mtr	UTSW	13	12231057	missense	probably damaging	1.00
R4655:Mtr	UTSW	13	12227793	missense	probably damaging	1.00
R4801:Mtr	UTSW	13	12195251	missense	probably benign	0.01
R4802:Mtr	UTSW	13	12195251	missense	probably benign	0.01
R4895:Mtr	UTSW	13	12216866	missense	probably benign	0.01
R5481:Mtr	UTSW	13	12188155	critical splice acceptor site	probably null
R5966:Mtr	UTSW	13	12215567	critical splice acceptor site	probably null
R6209:Mtr	UTSW	13	12190392	missense	probably benign	0.00
R6348:Mtr	UTSW	13	12247954	missense	possibly damaging	0.49
R6463:Mtr	UTSW	13	12216866	missense	probably benign	0.01
R6467:Mtr	UTSW	13	12188106	missense	probably damaging	1.00
R7046:Mtr	UTSW	13	12190209	missense	possibly damaging	0.58
R7505:Mtr	UTSW	13	12221476	missense	probably benign	0.02
R7575:Mtr	UTSW	13	12199077	missense	probably benign	0.01
R7705:Mtr	UTSW	13	12249896	missense	probably benign
R7748:Mtr	UTSW	13	12227839	missense	probably benign	0.00
R8161:Mtr	UTSW	13	12221486	missense	probably damaging	0.99
R8290:Mtr	UTSW	13	12190253	missense	probably damaging	1.00
R8988:Mtr	UTSW	13	12235479	missense	probably benign
R9050:Mtr	UTSW	13	12216862	missense	probably null	0.67
R9420:Mtr	UTSW	13	12253878	missense	probably benign	0.04
X0064:Mtr	UTSW	13	12250657	missense	probably damaging	1.00
Z1177:Mtr	UTSW	13	12187049	missense	probably benign	0.32
Z1177:Mtr	UTSW	13	12249866	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCGCTGACAAGACAGAGACTACTG -3'
(R):5'- GAGTGAGCCCCTAATGAAAGTGCAG -3'

Sequencing Primer
(F):5'- AGAGATGACTTCATCCTAAGTTCTCC -3'
(R):5'- GAAAGTGCAGTTTTTCCTGACC -3'

Posted On

2014-01-05