Incidental Mutation 'R1101:Eif3l'
ID98132
Institutional Source Beutler Lab
Gene Symbol Eif3l
Ensembl Gene ENSMUSG00000033047
Gene Nameeukaryotic translation initiation factor 3, subunit L
SynonymsD15N1e, Eif3s6ip, Eif3eip, PAF67, 0610011H21Rik, HSP-66Y
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R1101 (G1)
Quality Score150
Status Not validated
Chromosome15
Chromosomal Location79075179-79094405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79075267 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 3 (Y3C)
Ref Sequence ENSEMBL: ENSMUSP00000038839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040518] [ENSMUST00000229310]
Predicted Effect probably damaging
Transcript: ENSMUST00000040518
AA Change: Y3C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038839
Gene: ENSMUSG00000033047
AA Change: Y3C

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
Pfam:Paf67 152 550 7e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229338
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Eif3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Eif3l APN 15 79076920 missense possibly damaging 0.82
IGL02457:Eif3l APN 15 79078096 missense probably benign 0.01
IGL02658:Eif3l APN 15 79076942 missense probably damaging 1.00
IGL02689:Eif3l APN 15 79086519 missense possibly damaging 0.77
IGL02797:Eif3l APN 15 79075277 missense probably benign 0.00
IGL02824:Eif3l APN 15 79075823 splice site probably null
IGL02957:Eif3l APN 15 79089828 missense probably benign 0.00
IGL03352:Eif3l APN 15 79077051 unclassified probably benign
R0528:Eif3l UTSW 15 79089609 missense probably benign 0.00
R0550:Eif3l UTSW 15 79076867 missense probably damaging 1.00
R0751:Eif3l UTSW 15 79075766 splice site probably null
R1184:Eif3l UTSW 15 79075766 splice site probably null
R1585:Eif3l UTSW 15 79084181 missense possibly damaging 0.63
R1895:Eif3l UTSW 15 79089477 missense possibly damaging 0.55
R2442:Eif3l UTSW 15 79085607 missense probably damaging 1.00
R4865:Eif3l UTSW 15 79081649 nonsense probably null
R5092:Eif3l UTSW 15 79084154 missense probably benign 0.01
R5239:Eif3l UTSW 15 79089795 missense possibly damaging 0.95
R5328:Eif3l UTSW 15 79093361 nonsense probably null
R6575:Eif3l UTSW 15 79086578 missense possibly damaging 0.67
R6624:Eif3l UTSW 15 79089929 missense probably damaging 1.00
R6875:Eif3l UTSW 15 79085560 missense probably damaging 0.99
R7484:Eif3l UTSW 15 79084136 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACTCCGTCCTTCCAATCAGAGC -3'
(R):5'- CACAGTAATAGCCCCGTCTGAAGC -3'

Sequencing Primer
(F):5'- TCCAATCAGAGCTACTTCGC -3'
(R):5'- TCCGACTGACTGCGACTAC -3'
Posted On2014-01-05