Incidental Mutation 'R1101:Igf2bp2'
ID98135
Institutional Source Beutler Lab
Gene Symbol Igf2bp2
Ensembl Gene ENSMUSG00000033581
Gene Nameinsulin-like growth factor 2 mRNA binding protein 2
SynonymsIMP-2, C330012H03Rik
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R1101 (G1)
Quality Score111
Status Not validated
Chromosome16
Chromosomal Location22059009-22163299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22162950 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 5 (L5Q)
Ref Sequence ENSEMBL: ENSMUSP00000097629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100052] [ENSMUST00000115379]
Predicted Effect probably damaging
Transcript: ENSMUST00000100052
AA Change: L5Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097629
Gene: ENSMUSG00000033581
AA Change: L5Q

DomainStartEndE-ValueType
RRM 4 72 8.2e-11 SMART
RRM 83 153 4.07e-6 SMART
KH 185 256 1.28e-14 SMART
KH 266 339 1.97e-15 SMART
low complexity region 375 391 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
KH 419 490 1.1e-13 SMART
KH 501 573 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115379
SMART Domains Protein: ENSMUSP00000111037
Gene: ENSMUSG00000033581

DomainStartEndE-ValueType
RRM 15 85 4.07e-6 SMART
KH 117 188 1.28e-14 SMART
KH 198 271 1.97e-15 SMART
low complexity region 307 323 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
KH 351 422 1.1e-13 SMART
KH 433 505 2.48e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129913
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the 5' UTR of insulin-like growth factor 2 (IGF2) mRNA and regulates its translation. It plays an important role in metabolism and variation in this gene is associated with susceptibility to diabetes. Alternative splicing and promoter usage results in multiple transcript variants. Related pseudogenes are found on several chromosomes. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Igf2bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Igf2bp2 APN 16 22063704 missense probably damaging 1.00
IGL02374:Igf2bp2 APN 16 22081868 missense probably benign 0.00
IGL02752:Igf2bp2 APN 16 22080110 missense probably benign 0.00
IGL02884:Igf2bp2 APN 16 22162885 missense probably benign 0.00
IGL03072:Igf2bp2 APN 16 22068141 critical splice donor site probably null
defender UTSW 16 22070306 critical splice donor site probably null
Petite UTSW 16 22079608 critical splice acceptor site probably null
R0008:Igf2bp2 UTSW 16 22076091 missense probably benign 0.22
R0183:Igf2bp2 UTSW 16 22078730 nonsense probably null
R0390:Igf2bp2 UTSW 16 22081801 missense possibly damaging 0.87
R0505:Igf2bp2 UTSW 16 22089099 missense possibly damaging 0.90
R0610:Igf2bp2 UTSW 16 22070309 missense probably benign 0.00
R0696:Igf2bp2 UTSW 16 22080125 missense probably benign 0.19
R0966:Igf2bp2 UTSW 16 22089090 missense probably damaging 1.00
R1159:Igf2bp2 UTSW 16 22061853 splice site probably benign
R1169:Igf2bp2 UTSW 16 22078730 nonsense probably null
R1762:Igf2bp2 UTSW 16 22083947 nonsense probably null
R2168:Igf2bp2 UTSW 16 22079608 critical splice acceptor site probably null
R4014:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4015:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4016:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4017:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4128:Igf2bp2 UTSW 16 22078621 missense probably benign 0.00
R4986:Igf2bp2 UTSW 16 22070306 critical splice donor site probably null
R5007:Igf2bp2 UTSW 16 22079496 missense probably damaging 1.00
R5268:Igf2bp2 UTSW 16 22079491 missense probably damaging 1.00
R5531:Igf2bp2 UTSW 16 22089085 missense probably damaging 1.00
R6154:Igf2bp2 UTSW 16 22076093 nonsense probably null
R6819:Igf2bp2 UTSW 16 22060836 missense probably damaging 1.00
R6975:Igf2bp2 UTSW 16 22061861 missense probably null 1.00
R7008:Igf2bp2 UTSW 16 22081832 missense probably benign 0.16
R7311:Igf2bp2 UTSW 16 22061882 missense possibly damaging 0.76
X0066:Igf2bp2 UTSW 16 22161291 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCACCCGAGAGGGTCTCGATGG -3'
(R):5'- GTCGCGTCCACCTTGCACACAC -3'

Sequencing Primer
(F):5'- TCTCGATGGCGCGGATG -3'
(R):5'- GCTCCAACTCTCAggcg -3'
Posted On2014-01-05