Mutagenetix > Incidental Mutations

Incidental Mutation 'R1101:Igf2bp2'

98135

Institutional Source

Beutler Lab

Gene Symbol

Igf2bp2

Ensembl Gene

ENSMUSG00000033581

Gene Name

insulin-like growth factor 2 mRNA binding protein 2

Synonyms

IMP-2, C330012H03Rik

MMRRC Submission

039174-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.254) question?

Stock #

R1101 (G1)

Quality Score

111

Status

Not validated

Chromosome

Chromosomal Location

22059009-22163299 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 22162950 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 5 (L5Q)

Ref Sequence

ENSEMBL: ENSMUSP00000097629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100052] [ENSMUST00000115379]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100052
AA Change: L5Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097629
Gene: ENSMUSG00000033581
AA Change: L5Q

Domain	Start	End	E-Value	Type
RRM	4	72	8.2e-11	SMART
RRM	83	153	4.07e-6	SMART
KH	185	256	1.28e-14	SMART
KH	266	339	1.97e-15	SMART
low complexity region	375	391	N/A	INTRINSIC
low complexity region	404	415	N/A	INTRINSIC
KH	419	490	1.1e-13	SMART
KH	501	573	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115379

SMART Domains

Protein: ENSMUSP00000111037
Gene: ENSMUSG00000033581

Domain	Start	End	E-Value	Type
RRM	15	85	4.07e-6	SMART
KH	117	188	1.28e-14	SMART
KH	198	271	1.97e-15	SMART
low complexity region	307	323	N/A	INTRINSIC
low complexity region	336	347	N/A	INTRINSIC
KH	351	422	1.1e-13	SMART
KH	433	505	2.48e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125926

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127696

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129913

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the 5' UTR of insulin-like growth factor 2 (IGF2) mRNA and regulates its translation. It plays an important role in metabolism and variation in this gene is associated with susceptibility to diabetes. Alternative splicing and promoter usage results in multiple transcript variants. Related pseudogenes are found on several chromosomes. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2610021A01Rik	C	A	7: 41,627,359	H829N	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abi3bp	G	T	16: 56,606,158	R512L	probably damaging	Het
Acot2	T	G	12: 83,992,850	S378A	probably benign	Het
Akap9	T	C	5: 4,046,205	I2360T	probably benign	Het
Bank1	T	C	3: 136,283,864	D155G	probably benign	Het
Bsn	A	G	9: 108,116,411	V714A	probably damaging	Het
Cdh15	G	A	8: 122,860,846	V170I	possibly damaging	Het
Clcn2	G	A	16: 20,703,595	T787I	probably damaging	Het
Dapk1	A	G	13: 60,716,785	H131R	probably damaging	Het
Dct	T	G	14: 118,036,622	D291A	probably damaging	Het
Dhx37	A	G	5: 125,415,152	Y1128H	probably damaging	Het
Dip2c	A	T	13: 9,634,744	I1174F	probably damaging	Het
Eif3l	A	G	15: 79,075,267	Y3C	probably damaging	Het
Enpp5	A	G	17: 44,081,367	N229S	possibly damaging	Het
Fam83b	A	T	9: 76,545,670	H38Q	possibly damaging	Het
Fcamr	T	A	1: 130,814,486		probably null	Het
Hdac2	G	A	10: 36,991,809	V184I	probably damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Ireb2	T	A	9: 54,909,702	H951Q	probably benign	Het
Lman1	T	A	18: 65,987,898	M418L	probably benign	Het
Lrrfip2	C	T	9: 111,190,225	R275W	probably damaging	Het
Mast3	T	A	8: 70,786,663	I424F	probably damaging	Het
Mep1a	T	C	17: 43,491,693	D147G	probably benign	Het
Mtr	C	A	13: 12,189,525	E1128D	possibly damaging	Het
Ogfod1	C	A	8: 94,064,304	S534R	probably benign	Het
Olfr1212	A	T	2: 88,958,984	I173F	possibly damaging	Het
Olfr1290	T	C	2: 111,489,442	T239A	probably damaging	Het
Olfr173	A	G	16: 58,797,252	V198A	probably benign	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pcdh18	T	A	3: 49,753,379	D882V	probably damaging	Het
Pik3cg	C	T	12: 32,195,646	G868S	probably null	Het
Plppr5	T	G	3: 117,662,523	M231R	probably damaging	Het
Polr2a	T	C	11: 69,748,071	T46A	probably benign	Het
Ppp4r3a	C	A	12: 101,051,571	R440L	probably damaging	Het
Serpinb9e	A	T	13: 33,260,088	T364S	probably benign	Het
Sirt3	A	G	7: 140,869,628	V135A	possibly damaging	Het
Supt16	T	C	14: 52,171,439	N826S	probably null	Het
Tbr1	T	C	2: 61,804,739	I11T	probably benign	Het
Trim72	A	G	7: 128,010,247	E407G	possibly damaging	Het
Vps72	C	A	3: 95,119,176	T144K	probably damaging	Het

Other mutations in Igf2bp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01074:Igf2bp2	APN	16	22063704	missense	probably damaging	1.00
IGL02374:Igf2bp2	APN	16	22081868	missense	probably benign	0.00
IGL02752:Igf2bp2	APN	16	22080110	missense	probably benign	0.00
IGL02884:Igf2bp2	APN	16	22162885	missense	probably benign	0.00
IGL03072:Igf2bp2	APN	16	22068141	critical splice donor site	probably null
defender	UTSW	16	22070306	critical splice donor site	probably null
Petite	UTSW	16	22079608	critical splice acceptor site	probably null
R0008:Igf2bp2	UTSW	16	22076091	missense	probably benign	0.22
R0183:Igf2bp2	UTSW	16	22078730	nonsense	probably null
R0390:Igf2bp2	UTSW	16	22081801	missense	possibly damaging	0.87
R0505:Igf2bp2	UTSW	16	22089099	missense	possibly damaging	0.90
R0610:Igf2bp2	UTSW	16	22070309	missense	probably benign	0.00
R0696:Igf2bp2	UTSW	16	22080125	missense	probably benign	0.19
R0966:Igf2bp2	UTSW	16	22089090	missense	probably damaging	1.00
R1159:Igf2bp2	UTSW	16	22061853	splice site	probably benign
R1169:Igf2bp2	UTSW	16	22078730	nonsense	probably null
R1762:Igf2bp2	UTSW	16	22083947	nonsense	probably null
R2168:Igf2bp2	UTSW	16	22079608	critical splice acceptor site	probably null
R4014:Igf2bp2	UTSW	16	22063676	missense	probably damaging	0.99
R4015:Igf2bp2	UTSW	16	22063676	missense	probably damaging	0.99
R4016:Igf2bp2	UTSW	16	22063676	missense	probably damaging	0.99
R4017:Igf2bp2	UTSW	16	22063676	missense	probably damaging	0.99
R4128:Igf2bp2	UTSW	16	22078621	missense	probably benign	0.00
R4986:Igf2bp2	UTSW	16	22070306	critical splice donor site	probably null
R5007:Igf2bp2	UTSW	16	22079496	missense	probably damaging	1.00
R5268:Igf2bp2	UTSW	16	22079491	missense	probably damaging	1.00
R5531:Igf2bp2	UTSW	16	22089085	missense	probably damaging	1.00
R6154:Igf2bp2	UTSW	16	22076093	nonsense	probably null
R6819:Igf2bp2	UTSW	16	22060836	missense	probably damaging	1.00
R6975:Igf2bp2	UTSW	16	22061861	missense	probably null	1.00
R7008:Igf2bp2	UTSW	16	22081832	missense	probably benign	0.16
R7311:Igf2bp2	UTSW	16	22061882	missense	possibly damaging	0.76
X0066:Igf2bp2	UTSW	16	22161291	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- TCACCCGAGAGGGTCTCGATGG -3'
(R):5'- GTCGCGTCCACCTTGCACACAC -3'

Sequencing Primer
(F):5'- TCTCGATGGCGCGGATG -3'
(R):5'- GCTCCAACTCTCAggcg -3'

Posted On

2014-01-05