Mutagenetix > Incidental Mutation

Incidental Mutation 'R1101:Enpp5'

98139

Institutional Source

Beutler Lab

Gene Symbol

Enpp5

Ensembl Gene

ENSMUSG00000023960

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 5

Synonyms

D17Abb1e

MMRRC Submission

039174-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1101 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44078813-44086567 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44081367 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 229 (N229S)

Ref Sequence

ENSEMBL: ENSMUSP00000122767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024756] [ENSMUST00000126032] [ENSMUST00000154166]

AlphaFold

Q9EQG7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024756
AA Change: N229S

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000024756
Gene: ENSMUSG00000023960
AA Change: N229S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Phosphodiest	30	342	7.1e-91	PFAM
transmembrane domain	430	452	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126032

Predicted Effect

possibly damaging
Transcript: ENSMUST00000154166
AA Change: N229S

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000122767
Gene: ENSMUSG00000023960
AA Change: N229S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Phosphodiest	30	342	2.1e-86	PFAM
transmembrane domain	430	452	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I transmembrane glycoprotein. Studies in rat suggest the encoded protein may play a role in neuronal cell communications. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2610021A01Rik	C	A	7: 41,627,359	H829N	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abi3bp	G	T	16: 56,606,158	R512L	probably damaging	Het
Acot2	T	G	12: 83,992,850	S378A	probably benign	Het
Akap9	T	C	5: 4,046,205	I2360T	probably benign	Het
Bank1	T	C	3: 136,283,864	D155G	probably benign	Het
Bsn	A	G	9: 108,116,411	V714A	probably damaging	Het
Cdh15	G	A	8: 122,860,846	V170I	possibly damaging	Het
Clcn2	G	A	16: 20,703,595	T787I	probably damaging	Het
Dapk1	A	G	13: 60,716,785	H131R	probably damaging	Het
Dct	T	G	14: 118,036,622	D291A	probably damaging	Het
Dhx37	A	G	5: 125,415,152	Y1128H	probably damaging	Het
Dip2c	A	T	13: 9,634,744	I1174F	probably damaging	Het
Eif3l	A	G	15: 79,075,267	Y3C	probably damaging	Het
Fam83b	A	T	9: 76,545,670	H38Q	possibly damaging	Het
Fcamr	T	A	1: 130,814,486		probably null	Het
Hdac2	G	A	10: 36,991,809	V184I	probably damaging	Het
Igf2bp2	A	T	16: 22,162,950	L5Q	probably damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Ireb2	T	A	9: 54,909,702	H951Q	probably benign	Het
Lman1	T	A	18: 65,987,898	M418L	probably benign	Het
Lrrfip2	C	T	9: 111,190,225	R275W	probably damaging	Het
Mast3	T	A	8: 70,786,663	I424F	probably damaging	Het
Mep1a	T	C	17: 43,491,693	D147G	probably benign	Het
Mtr	C	A	13: 12,189,525	E1128D	possibly damaging	Het
Ogfod1	C	A	8: 94,064,304	S534R	probably benign	Het
Olfr1212	A	T	2: 88,958,984	I173F	possibly damaging	Het
Olfr1290	T	C	2: 111,489,442	T239A	probably damaging	Het
Olfr173	A	G	16: 58,797,252	V198A	probably benign	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pcdh18	T	A	3: 49,753,379	D882V	probably damaging	Het
Pik3cg	C	T	12: 32,195,646	G868S	probably null	Het
Plppr5	T	G	3: 117,662,523	M231R	probably damaging	Het
Polr2a	T	C	11: 69,748,071	T46A	probably benign	Het
Ppp4r3a	C	A	12: 101,051,571	R440L	probably damaging	Het
Serpinb9e	A	T	13: 33,260,088	T364S	probably benign	Het
Sirt3	A	G	7: 140,869,628	V135A	possibly damaging	Het
Supt16	T	C	14: 52,171,439	N826S	probably null	Het
Tbr1	T	C	2: 61,804,739	I11T	probably benign	Het
Trim72	A	G	7: 128,010,247	E407G	possibly damaging	Het
Vps72	C	A	3: 95,119,176	T144K	probably damaging	Het

Other mutations in Enpp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00583:Enpp5	APN	17	44085197	splice site	probably benign
IGL01593:Enpp5	APN	17	44080721	missense	probably benign
IGL01654:Enpp5	APN	17	44081175	missense	possibly damaging	0.82
IGL02120:Enpp5	APN	17	44080845	missense	probably benign	0.04
IGL02142:Enpp5	APN	17	44085577	missense	probably benign	0.01
IGL02531:Enpp5	APN	17	44080952	missense	probably damaging	1.00
IGL02630:Enpp5	APN	17	44082875	missense	probably damaging	1.00
Cacao	UTSW	17	44085576	missense	probably benign	0.00
canola	UTSW	17	44085264	missense	probably damaging	1.00
R2074:Enpp5	UTSW	17	44085373	missense	probably benign	0.25
R2679:Enpp5	UTSW	17	44085388	missense	probably damaging	1.00
R4739:Enpp5	UTSW	17	44081136	missense	probably damaging	1.00
R4817:Enpp5	UTSW	17	44080980	makesense	probably null
R5152:Enpp5	UTSW	17	44081133	missense	probably damaging	1.00
R6021:Enpp5	UTSW	17	44085319	missense	probably benign	0.22
R6160:Enpp5	UTSW	17	44081368	missense	possibly damaging	0.77
R6330:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6385:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6387:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6452:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6454:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6461:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6462:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6463:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6469:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6470:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6471:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6473:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6505:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6563:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6564:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6760:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6812:Enpp5	UTSW	17	44085576	missense	probably benign	0.00
R6821:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6824:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6963:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6965:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7169:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7171:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7375:Enpp5	UTSW	17	44080977	missense	probably benign	0.02
R7393:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7394:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7411:Enpp5	UTSW	17	44081475	missense	probably damaging	1.00
R7412:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7446:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7447:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7560:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7561:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7589:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7590:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7591:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R8211:Enpp5	UTSW	17	44081511	critical splice donor site	probably null
R9256:Enpp5	UTSW	17	44085523	missense	probably benign	0.00
R9321:Enpp5	UTSW	17	44082798	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- GAAGATCCACGATAGTTTCCCGACC -3'
(R):5'- ACATACCTTCTTTTGGCAGGATGGC -3'

Sequencing Primer
(F):5'- CAGAGTTGCCAAAATCATTGAGTG -3'
(R):5'- CAGCTACAGGTGAGTGATCAATC -3'

Posted On

2014-01-05