Incidental Mutation 'R1101:Lman1'
ID98141
Institutional Source Beutler Lab
Gene Symbol Lman1
Ensembl Gene ENSMUSG00000041891
Gene Namelectin, mannose-binding, 1
Synonymsgp58, F5F8D, ERGIC53, MCFD1, P58, 2610020P13Rik, MR60
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.740) question?
Stock #R1101 (G1)
Quality Score220
Status Not validated
Chromosome18
Chromosomal Location65980754-66022580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65987898 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 418 (M418L)
Ref Sequence ENSEMBL: ENSMUSP00000113326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048260] [ENSMUST00000120461]
Predicted Effect probably benign
Transcript: ENSMUST00000048260
AA Change: M418L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040140
Gene: ENSMUSG00000041891
AA Change: M418L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Lectin_leg-like 52 277 2.2e-95 PFAM
low complexity region 291 307 N/A INTRINSIC
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120461
AA Change: M418L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113326
Gene: ENSMUSG00000041891
AA Change: M418L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Lectin_leg-like 52 277 2.2e-95 PFAM
low complexity region 291 307 N/A INTRINSIC
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155895
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane mannose-specific lectin that cycles between the endoplasmic reticulum, endoplasmic reticulum-Golgi intermediate compartment, and cis-Golgi, functioning as a cargo receptor for glycoprotein transport. The protein has an N-terminal signal sequence, a calcium-dependent and pH-sensitive carbohydrate recognition domain, a stalk region that functions in oligomerization, a transmembrane domain, and a short cytoplasmic domain required for organelle targeting. Allelic variants of this gene are associated with the autosomal recessive disorder combined factor V-factor VIII deficiency. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit strain dependent postnatal lethality and slightly dilated endoplasmic reticulum in hepatocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Lman1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00644:Lman1 APN 18 65997622 nonsense probably null
IGL01098:Lman1 APN 18 65991640 missense probably damaging 1.00
IGL01347:Lman1 APN 18 65991610 missense probably damaging 0.99
IGL01701:Lman1 APN 18 65994850 missense possibly damaging 0.91
IGL03331:Lman1 APN 18 65993204 missense probably benign 0.00
R1434:Lman1 UTSW 18 65993073 critical splice donor site probably null
R1785:Lman1 UTSW 18 65991582 missense probably damaging 0.99
R1786:Lman1 UTSW 18 65991582 missense probably damaging 0.99
R1794:Lman1 UTSW 18 65991684 missense probably benign 0.21
R2038:Lman1 UTSW 18 65998610 missense probably benign 0.30
R2060:Lman1 UTSW 18 65998352 intron probably benign
R2940:Lman1 UTSW 18 65984273 missense possibly damaging 0.77
R4125:Lman1 UTSW 18 65987861 missense possibly damaging 0.66
R4471:Lman1 UTSW 18 65991726 unclassified probably benign
R4751:Lman1 UTSW 18 65998434 missense probably benign 0.06
R7021:Lman1 UTSW 18 65991643 missense probably benign 0.02
R7199:Lman1 UTSW 18 65994865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTAGGAATGAGACCATGCTGCG -3'
(R):5'- ACTTGTGTCAGGAATCCCTGAGACC -3'

Sequencing Primer
(F):5'- CGCAGAACCAGTTACCATGC -3'
(R):5'- agattctgaatttgacctttcctg -3'
Posted On2014-01-05